Regulation of Cutaneous Malignancy by γδ T Cells

Janeway C. A., Jones B., Hayday A., Immunol. Today 9, 73 (1988).

Groh V., et al., Proc. Natl. Acad. Sci. U.S.A. 96, 6879 (1999).

Asarnow D., et al., Cell 55, 837 (1988).

Cerwenka A., et al., Immunity 12, 721 (2000).

Diefenbach A., Jamieson A., Liu S., Shastri N., Raulet D., Nature Immunol. 2, 119 (2000).

Fusenig N., Amer S., Boukamp P., Worst P., Bull. Cancer 65, 271 (1978).

PDV cells were trypsinized, washed three times, and resuspended in phosphate-buffered saline before intradermal injection (i.e., raising a bleb) with a 25-gauge needle into C57BL/6 mice at 10⁶ cells per site. Mice were observed weekly for palpable tumors, which were measured with calipers in two directions to determine tumor area. Mice were killed for tumors measuring greater than 100 mm². All experiments using animals were carried out in facilities accredited by the Association for Assessment and Accreditation of Laboratory Animal Care.

Kaplan D., et al., Proc. Natl. Acad. Sci. U.S.A. 95, 7556 (1998).

Wild-type, TCRδ^–/–, and TCRβ^–/– C57BL/6 mice (Jackson) were backcrossed to FVB (Taconic) for ≥11 generations. Repeat testing failed to identify known bacterial pathogens, mites, or pinworms on the skin. All mice used were ∼8 weeks of age. Mice were injected intradermally (i.e., raising a visible bleb) with 5 μg of 3-MCA (Fluka) in 100 μl of peanut oil (Sigma) into the right flank using a ¾-inch 27-gauge needle. Mice were inspected and tumors examined every 1 to 2 weeks (7).

Owens D., Wei S., Smart R., Carcinogenesis 20, 1837 (1999).

Initiation was by pipette application of 100 nmol of DMBA (Sigma) in acetone onto the back skin of 8-week-old mice, 1 week after shaving hair with electric clippers. Promotion was weekly with 5 or 40 nmol of TPA (Sigma). Mice were assessed every 1 to 2 weeks for tumor development, and tumors were counted and scored as clinically apparent papillomas (typically well-demarcated, symmetrical, pedunculated, or dome-shaped papules, without erosion or ulceration) or clinically apparent carcinomas (poorly demarcated, asymmetrical, nonpedunculated, or dome-shaped papules with erosion or ulceration).

Mombaerts P., et al., Nature 365, 53 (1993).

Shankaran V., et al., Nature 410, 1107 (2001).

Hanahan D., Weinberg R., Cell 100, 57 (2000).

Coussens L., Werb Z., J. Exp. Med. 193, F23 (2001).

To express biotinylated type II integral membrane proteins COOH-terminal to d3+4 of rat CD4, we modified plasmid pBSKS-XB (17). The resulting vector, pBSKS type II (containing Xba I–CD4L–Sal I– BirA–Xma I–CD4 d3+4–Eco RI–stop–Bam HI), was designed such that the synthetic BirA substrate peptide SGSLHHILDAQKMVWNHR (40) is NH₂-terminal to the mature protein. Murine NKG2d cDNA, amplified from C57BL6 lymph node using primers GGAA- TTCAGGCGGCGGCTCCTTTCAGCCAGTATTGTGCAAC and GATATCTGATCAAGATCTTTACACCGCCCTTTTCATGCAG, was ligated into the pBSKS Type II vector via Eco RI and Bam HI. The coding fragment (Xba I–Bgl II) was subcloned into the expression vector pEF-BOS (18). Recombinant proteins were expressed in 293T cells with supernatants harvested at 72 hours and again 72 hours later. Harvests were assayed by Western blot with OX68 (antibody to rat CD4) and by CD4-inhibition ELISA (enzyme-linked immunosorbent assay); NKG2d chimeras were routinely expressed at ∼20 μg/ml. On nonreduced SDS gels, NKG2d-CD4d3+4 chimeras ran at ∼110 kD. For biotinylation, supernatants were exchanged 1:100 into 10 mM tris-HCl (pH 8.0) and concentrated for addition of 1 μl of BirA biotin ligase (Avidity) per 0.7 ml of concentrate. Unreacted biotin was removed by dialysis. Biotinylation was assessed by depletion with avidin-coated beads and OX68 Western blot of residual supernatants. For cell staining, 200 μl of avidin-coated 0.5-μm pink fluorescent particles (Spherotech) were resuspended in 400 μl of biotin-CD4-NKG2d for 1 to 2 hours at 4°C, pelleted, and resuspended in 200 μl of RPMI medium. PDV cells were dissociated by agitation and 0.5 mM EDTA. Treatment with PLCgamma (5 U/ml, Sigma) was for 1 hour at 37°C with mixing every 10 min. Cell staining took place on ice for 1 hour with mixing. Tubes were flooded with 1.5 ml of RPMI; cells were pelleted by centrifugation and analyzed in a Coulter or Cytomation MoFlo flow cytometer.

Brown M. H., et al., J. Exp. Med. 188, 2083 (1998).

Mizushima S., Nagata S., Nucleic Acids Res. 18, 5322 (1990).

Malarkannan S., et al., J. Immunol. 161, 3501 (1998).

Rae-1ε cDNA was amplified from PDV cells using primers AAAATCTAGAGAAACCATGGCCAAGGCAGCAGTGACC and AAAAATGTCGACCCAGATATGAAGATGAGTCCCACAGAG. The GenBank accession number for Rae-1ε is.

Nomura M., et al., J. Biochem. (Tokyo) 120, 987 (1996).

Supplementary information is available at Science Online (www.sciencemag.org/cgi/content/full/1063916/DC1).

Rae-1ε cDNA was cloned into the Xba I–Sal I sites of the Type I pEF-BOS vector containing CD4 d3+4 and the BirA substrate peptide. Magnetic beads were coated with either biotinylated Rae-1ε CD4 d3+4 or CD4 d3+4 and incubated with 2 nmol of nonbiotinylated NKG2d for 5 hours at 4°C with rocking before pelleting on a magnet. Bound and unbound proteins were determined after dissociation by SDS–polyacrylamide gel electrophoresis (PAGE) and Western blotting with OX68. Nonbiotinylated NKG2d and Rae-1ε were affinity-purified on an OX68 column and acid-eluted in 0.2 M acetate, 500 mM NaCl buffer. After neutralization, proteins were concentrated, run on SDS-PAGE, and silver-stained to assess purity. Protein concentrations were measured by BCA protein assay (Sigma).

Surface plasmon resonance experiments were done in the Biacore-X (Biacore AB). Dilutions of Rae-1ε analyte in HBS-P (Biacore AB) with 5 mM calcium were injected over 7 s at 100 μl/min into flow cells containing 500 RU of biotinylated NKG2d coupled to a streptavidin-coated chip or a reference cell containing ∼500 RU of biotinylated CD4 domains 3 and 4. Rae-1ε analytes were gel-filtered just before experiments.

Sanchez L. M., Chirino A. J., Bjorkman P., Science 283, 1914 (1999).

Candidate template structures for Rae-1 were identified using the fold recognition program 3dPSSM. ZAG (PDB code 1ZAG) gave the highest score; other MHC-related molecules also scored highly. The Rae-1 sequence was threaded onto template Cα traces, and full coordinates were generated using the program HOMOLOGY (in INSIGHT, Molecular Simulations Inc.), with loops modeled with GENLOOP where necessary. A phylogenetic tree was generated using the multisequence alignment ClustalW and GeneBee bioinformatics resources.

Li P., et al., Nature Immunol. 2, 443 (2001).

Wolan D. W., et al., Nature Immunol. 2, 248 (2001).

Cosman D., et al., Immunity 14, 123 (2001).

Ho E. L., et al., Proc. Natl. Acad. Sci. U.S.A. 95, 6320 (1998).

J. Coligan et al., Current Protocols in Immunology (Wiley, New York, 1991).

Soluble Rae-1ε was prepared as described (24) and used at a final concentration of 1 μg/ml.

J. M. Lewis, R. E. Tigelaar, unpublished data.

Rats were immunized with recombinant murine NKG2d–rat CD4d3+4 chimerae purified to homogeneity, as detected by silver staining of electrophoresed protein (24). The antiserum recognized the immunogen in ELISA and Western blots, with negligible reactivity toward CD4 d3+4. It immunoprecipitated one specific species from DETC lines, by comparison with normal rat serum.

Groh V., et al., Nature Immunol. 2, 255 (2001).

RNA was prepared by trizol (Gibco) from cell pellets, from adherent cells lysed in flasks, from fresh organ samples homogenized directly into trizol using an electric homogenizer, from normal skin, or from skin lesion samples that were snap-frozen in liquid nitrogen and ground with mortar and pestle. Conditions for all standard PCRs: 3 min at 96°C (45 s at 96°C, 45 s at 56°C, 1 min at 72°C), 30 cycles; 10 min at 72°C. PCR primers for mouse H60: sense, GAAGACCATGGCAAAGGGAGCC; antisense, TTTTTCTTCAGCATACACCAAGCGAATACC (products are 774 and 550 bp); Rae-1: sense, GAAACCATGGCCAAGGCAGCAGTGACC; antisense, AGATATGAAGATGAGTCCCACAGAG (product is 762 bp); hypoxanthine-guanine phosphoribosyltransferase (HPRT): forward, GTTGGATACAGGCCAGACTTTGTTG; reverse, GAGGGTAGGCTGGCCTATGGCT (product is 352 bp); β-actin: sense, CTGAAGTACCCCATTGAACATGGC; antisense, CAGAGCAGTAATCTCCTTCTGCAT (product is 762 bp).

Marshall V., Transplantation 17, 272 (1974).

Holtmeier W., et al., J. Invest. Dermatol. 116, 275 (2001).

M. Girardi, J. Lewis, A. C. Hayday, R. E. Tigelaar, unpublished data.

Single-letter abbreviations for amino acid residues are as follows: A, Ala; C, Cys; D, Asp; E, Glu; F, Phe; G, Gly; H, His; I, Ile; K, Lys; L, Leu; M, Met; N, Asn; P, Pro; Q, Gln; R, Arg; S, Ser; T, Thr; V, Val; W, Trp; and Y, Tyr.

We thank A. Balmain for PDV cells and for discussions on oncology regimens; M. Brown for help with the development of polyvalent staining reagents; J. Steel for generating antisera; many colleagues, particularly A. Turner for advice; and W. Turnbull for flow cytometry. Supported by Wellcome Trust grant 05308 (A.C.H.), NIH AI grant 27855 (R.E.T.), and an NIH KO8 grant (M.G.). C.R.S. is a HHMI predoctoral fellow.