Canine Prostate Carcinomas Express Markers of Urothelial and Prostatic Differentiation
Abstract
Prostate carcinoma and transitional cell carcinoma (TCC) occur in the prostate gland of older dogs and have morphologic similarities when evaluated by light microscopy. The dog is a commonly used animal model for studying human prostate carcinoma; therefore, it is important to accurately differentiate canine prostate carcinomas from TCCs. We investigated whether keratin 7 (K7) and arginine esterase (AE) would aid differentiation of canine prostate carcinoma from TCC. K7 expression was evaluated in normal and neoplastic canine prostate and bladder tissues using immunohistochemistry. The expression of AE messenger ribonucleic acid (mRNA) in normal and neoplastic canine prostate and bladder was detected using northern blots and reverse transcriptase-polymerase chain reaction (RT-PCR). In addition, AE enzyme activity was measured in normal and neoplastic canine prostate and bladder tissues. We found marked similarities in K7 expression in prostate carcinomas and TCCs. AE mRNA was present in high levels in normal prostatic tissue but was reduced in prostate carcinoma by northern blot assay. Nested RT-PCR detected AE mRNA both in TCCs (13 of 15) and in prostate carcinomas (13 of 13). Enzymatic activity of AE was high in normal prostate gland and in some prostate carcinomas, whereas normal bladder and TCCs produced lower levels of AE. In conclusion, K7 and AE cannot be used to differentiate TCC from prostate carcinoma in dogs.
Prostate carcinoma is the most common solid malignancy in men and is a rapidly growing cause of morbidity and mortality in Western populations. Prostate carcinoma incidence is decreasing because of heightened awareness and successful screening programs directed at early detection.29 However, despite the importance of prostatic carcinoma as a leading cause of cancer deaths, there are few animal models appropriate for investigating the pathogenesis and progression of prostate cancer. Prostatic disease is rare in animals, with the exception of dogs. Dogs are the only large mammals other than man to develop prostatic neoplasia13,33 and have been used for studying benign and malignant dysregulation of prostate growth since the early 20th century. Investigations of naturally occurring disease and experimentally induced hyperplasia of the canine prostate gland have provided insights into the pathogenesis of prostatic diseases, such as benign prostatic hyperplasia (BPH),18 prostatic intraepithelial neoplasia,32 and prostate carcinoma,22 of men and dogs.
Several retrospective, morphologic studies of canine prostate cancers have been published in an attempt to gain an insight into the etiology and pathogenesis of human prostate carcinoma.11,22,30 The majority of the primary cancers of the canine prostate gland are characterized histopathologically as either prostatic adenocarcinomas or transitional cell carcinomas (TCCs), although other neoplasms, such as squamous cell carcinoma, hemangiosarcoma, and lymphoma, have been reported.24
The diagnosis of canine prostatic neoplasms is controversial because many primary prostatic carcinomas in dogs frequently have morphologic features similar to those found in TCC. Some investigators have even characterized a subclass of canine prostatic carcinomas as exhibiting a “urothelial-type” morphology.11 In this context, it is interesting that several studies have reported a high percentage of bladder “metastases” in cases of canine prostate carcinoma.15,31,34 Taken together, these findings indicate that it is often difficult to distinguish prostatic carcinomas from TCCs arising in the prostatic urethra or prostatic ducts, which have invaded the prostate. Canine prostate carcinomas, therefore, may arise from glandular or ductular epithelium of the prostate or from urothelium of the prostatic urethra; but, in most cases, the precise cellular origin of prostate cancer in dogs is unknown.
The cellular origin of canine prostatic carcinomas has not been identified because there are currently no specific markers for canine tissues that will allow discrimination of neoplasms arising from transformed prostatic glandular and ductal epithelia or urothelium. Markers useful for identifying prostate tissue in humans, such as prostate-specific antigen (PSA) and prostatic acid phosphatase (PAP), have variable results when applied to canine prostate tissue.2,5,25 Although the canine prostate does not produce PSA, it does secrete a similar serine protease, arginine esterase (AE).7 AE is a member of the kallikrein gene family and has 58% amino acid homology with PSA.10 AE has trypsinlike cleavage specificity (as opposed to the chymotrypsin-like cleavage specificity of PSA), which can be used to identify AE enzyme activity by spectrophotometric analysis of cleavage of a synthetic substrate benzoyl arginine ethyl ester (BAEE).14
In addition to analysis of tissue-specific enzyme activity, another useful tool for identifying the histologic origin of a variety neoplasms is the analysis of intermediate filaments.9,28 The keratins are a family of intermediate filament cytoplasmic proteins expressed by epithelial cells. Keratin 7 (K7) is produced by a variety of epithelial tissues, including bronchial and transitional epithelia26, and its expression has been evaluated in normal and neoplastic tissues from humans8 and animals.17 K7 is an especially useful marker for differentiating TCC from prostatic adenocarcinoma in men with anaplastic prostatic cancers that do not produce PSA.4 Although K7 expression has been proposed as a diagnostic tool to identify invasion of the canine prostate by urothelial carcinomas,20 there are few studies of K7 expression in prostate and TCCs in dogs.
To investigate the origin of canine prostatic neoplasms, we analyzed K7 and AE expression in normal canine prostate and urothelium and compared our findings with malignancies arising in these tissues.
Materials and Methods
Selection of case materials
K7 immunohistochemistry of normal and neoplastic canine bladder and prostate was performed on 51 paraffin-embedded tissue blocks obtained from the Department of Veterinary Biosciences at the Ohio State University, the Tufts University School of Veterinary Medicine, and a private veterinary diagnostic laboratory (Veterinary Diagnostics Ltd., Columbus, OH). To avoid inclusion of prostate carcinomas in the bladder TCCs studied, most (17 of 19) of the neoplasms were from female dogs. Tumors designated as prostate carcinoma were selected on the basis of the gross and microscopic pathology. Most of the prostate carcinomas (12 of 17) occurred in castrated dogs. Prostate carcinoma diagnosis was limited to those cases showing no evidence of urinary bladder involvement. Prostate carcinomas were diagnosed histologically based on the tissue morphologic characterization of Leav and Ling.22 Most tumors were categorized as intra-alveolar on the basis of the presence of acini or ducts containing papillary to solid projections of neoplastic epithelial cells. The tumors were usually multilobular with neoplastic acini separated by connective tissue stroma or were solid sheets of neoplastic cells with very little intervening stroma. Only one case was diagnosed as the small acinar morphology of canine prostate carcinoma.
K7 immunohistochemistry
K7 immunohistochemistry was performed on unstained, 4-µm paraffin sections that were dewaxed in xylenes and rehydrated through graded ethanols and water. Rehydrated sections were washed in phosphate-buffered saline (PBS) for 20 minutes. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide for 30 minutes at 25 C. Sections were washed in PBS for 20 minutes and incubated in 2% normal horse serum for 20 minutes at 25 C to block nonspecific protein binding. Sections were incubated with mouse anti-human K7 antibody (1 : 100 dilution) (clone 0137; DAKO, Carpinteria, CA) for 16 hours at 4 C. Negative control slides were incubated with normal horse serum. After incubation with primary antibody, sections were washed in PBS for 20 minutes. A biotinylated horse anti-mouse IgG secondary antibody (Vector Laboratories, Burlingame, CA) was applied to the sections for 1 hour at 25 C. Sections were washed in PBS for 20 minutes, and a commercial kit (Vecta-Stain Elite ABC; Vector Laboratories) was used to detect antibody binding. Diaminobenzidine (DAB) was used as the horseradish peroxidase–catalyzed chromogen. After detection, sections were dehydrated with graded ethanol and xylenes and coverslipped. Some sections were counterstained with hematoxylin. K7 expression was evaluated semiquantitatively by light microscopy as the percentage of tumor cells staining positively (0 = no K7 immunoreactivity; + = 0–33% cells positive; ++ = 34–66% positive; +++ = 67–100% positive) and as the percent staining intensity of the positive cells (0 = no K7 staining; + = mild intensity; ++ = moderate intensity; +++ = marked intensity).
Northern blot and reverse transcriptase–polymerase chain reaction amplification of arginine esterase messenger ribonucleic acid
Reverse transcriptase–polymerase chain reaction and complementary deoxyribonucleic acid cloning of AE from normal canine prostate
Total ribonucleic acid (RNA) was extracted from frozen normal canine prostate tissue using RNAwiz (Ambion, Austin, TX). Complementary deoxyribonucleic acid (cDNA) was prepared from 5 µg RNA using 50 U SuperScript II reverse transcriptase (RT) (Invitrogen, Carlsbad, CA), 50 ng/µl control RNA, 10 mM diethylnitrophyenyl thiophosphate (dNTP) mixture, and 0.5 µg/µl oligo(dT)12–18. Reverse transcription was performed at 42 C for 50 minutes, and the reaction was terminated at 70 C for 15 minutes and immediately chilled on ice. Ribonuclease (RNase) H was added and incubated at 37 C for 20 minutes. PCR was performed with cDNA obtained from reverse transcription using the following primers—sense: 5′-CTCACTGTCTGCCAGCTCCCA-3′; antisense: 5′-CCATCCAGAGACATAGC-3′. PCR was performed by incubating the samples at 94 C for 2 minutes, denaturing at 94 C for 30 seconds, annealing at 58 C for 30 seconds, and extension at 70 C for 1 minute for 35 cycles with platinum Taq DNA polymerase (GIBCO Invitrogen, Grand Island, NY) using an iCycler (Bio-Rad, Hercules, CA). The samples were analyzed on a 1.5% agarose gel. The 503–base pair fragment was cloned using TOPO TA (Invitrogen, Grand Island, NY) and the plasmid expressed in DH5α cells. The plasmid was purified by miniprep (QIA Prep Kit; Qiagen, Valencia, CA), sequenced, and the insert was confirmed to have 100% homology to the published sequence of canine AE cDNA (GenBank Y00751).
Northern blot assay
Northern blot analysis was performed on a 1.5% formaldehyde–MOPS gel run for 90 minutes at 70 V using total RNA from normal canine prostate and a prostate carcinoma. RNAs were transferred to a nylon membrane (Duralon; Invitrogen, Grand Island, NY) and cross-linked with ultraviolet light (Stratalinker; Stratagene, La Jolla, CA). The membrane was hybridized for 18 hours at 42 C with a 32P-deoxyadenosine triphosphate–labeled probe (503–base pairs) for canine AE as described above. Prehybridization and hybridization were performed using QuickHyb solution (Stratagene) following the manufacturer's instructions. The membrane was washed twice in 2× standard saline citrate (SSC) buffer for 15 minutes followed by a 30-minute wash in 0.1× SSC at 60 C. The blot was developed by autoradiography and quantitated by densitometric analysis using a PhosphorImager (Model 445si; Molecular Dynamics, Sunnyvale, CA) and quantified using ImageQuant Software (Molecular Dynamics).
RNA extraction from paraffin tissue sections
RNA was extracted from the archival formalin-fixed paraffin blocks of two normal prostates, one normal bladder, 13 prostate carcinomas, and 15 TCCs using a commercially available kit (Paraffin Block RNA Isolation Kit; Invitrogen, Carlsbad, CA). Four sections (20 µm) were cut from each block and placed in a clean 1.5-ml microfuge tube. RNA extraction was performed as described. Briefly, sections were deparaffinized with xylenes and 100% ethanol with mild agitation. Tissues were digested with proteinase K, RNA extraction buffer was added, and tissues incubated for 5 minutes at 25 C. Acid–phenol chloroform (700 µl) was added, mixed vigorously, and incubated at 25 C for 5 minutes followed by centrifugation at 19,000 × g for 5 minutes at 4 C. The supernatant was transferred to a fresh tube, and 1 µl of acrylamide was added to increase RNA yield. The supernatant was incubated with an equal volume of isopropanol at −20 C for 30 minutes to precipitate RNA. Precipitated RNA was pelleted at 19,000 × g for 15 minutes at 4 C. The RNA pellet was washed with 75% ethanol and resuspended in 10 µl of RNA Storage Solution (Ambion). The RNA was deoxyribonuclease-digested before reverse transcription was performed.
Reverse transcription
RNA isolated from tissue sections was reverse transcribed using a commercial kit (Super Script II, Invitrogen, Carlsbad, CA). Reverse transcription was performed with 5 µl of RNA, 100 ng of random hexamers, and diethyl pyrocarbonate (DEPC)–treated water. The RNA-primer mixture was incubated at 65 C for 5 minutes and then incubated on ice. After incubation, 2 µl of 10× RT buffer, 2 µl of 25 mM magnesium chloride, 1 µl of 10 mM dNTP mix, and 2 µl of 0.1 M dithiothreitol were added and incubated at 42 C for 2 minutes. Reverse transcription was initiated with 1 µl (50 U) of Super Script II RT. Each reaction was incubated at 42 C for 50 minutes. Reactions were terminated by chilling on ice after a final extension at 70 C for 15 minutes. One microliter (2 U) of RNase H was added to each tube and incubated at 37 C for 20 minutes.
Nested PCR
Two sets of nested primers (Table 1) that crossed exon-intron boundaries were designed for the coding region of canine AE cDNA using the published sequence (GenBank Y00751, M63669). All the primers were resuspended in Ultra Pure Water (Invitrogen, Carlsbad, CA) at 10 µM concentration. PCR reactions (50 µl) were carried out with 5 µl of 10× PCR buffer, 1.5 µl of 50 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl each of a 10-µM solution of the forward and the reverse primers for each set, 0.3 µl (1.5 U) of Taq polymerase, 5% (1 µl) of the cDNA obtained from reverse transcription, and DEPC water (final volume 50 µl). Initial denaturation was performed at 94 C for 4 minutes followed by 30 cycles of denaturation at 94 C for 30 seconds, annealing at 58 C, and extension at 72 C for 30 seconds. The final extension step was 72 C for 7 minutes. The first round of amplification was performed with the outer set of primers. The second round was performed using the same protocol but contained 1 µl of amplified DNA from the first reaction as the template and the inner set of primers. The PCR products were analyzed on a 2% agarose gel with ethidium bromide. The sizes of the PCR products were measured with a 1-Kb Plus Molecular Weight Ladder (Invitrogen, Carlsbad, CA).
| Primer Name | 5′ to 3′ Sequence | Size of Amplicon (base pairs) |
|---|---|---|
|
|
||
| Outer NAE-1 | GGAAGAGCCCGCCAAGATAACAAAA | 224 |
| Outer NAE-2 | ACCAGCACACAGCATGAACTTTGT | |
| Inner NAE-3 | AGTACCTGCTATGTCTCTGGATGG | 73 |
| Inner NAE-4 | ACTGGAGACTCCCTGGGTGAAA | |
| Outer NAE-5 | TTTCACCCAGGGAGTCTCCAGTGT | 204 |
| Outer NAE-6 | TGGAGTAGCCCCCCATGATGT | |
| Inner NAE-7 | ACAAAGTTCATGCTGTGTGCTGGT | 84 |
| Inner NAE-8 | ATCACATATCAGAGGGCCTCCTGAGT | |
|
|
||
AE activity
AE activity was measured in five normal prostates, three normal bladders, two TCCs, and four prostate carcinomas as described.14 Samples not immediately assayed were snap-frozen in liquid nitrogen and stored at −80 C for up to 1 year. Briefly, 1 g pieces of fresh or fresh-frozen tissue were homogenized on ice (four to six cycles, 60–120 seconds per cycle) with a Tissue-Tearor (Biospec Products, Bartlesville, OK) in 5.0 ml cold PBS containing protease inhibitors (Complete Mini Protease Inhibitor Tablets; Roche Molecular Biochemicals, Indianapolis, IN) and 0.01% Triton X-100 (Sigma Chemical Co., St. Louis, MO). Homogenates were clarified by centrifugation at 20,000 × g for 45 minutes at 4 C, and the supernates were stored at −80 C until assayed. Total protein concentration of the supernates was measured with the bicinchoninic acid protein assay (Pierce, Rockford, IL). AE enzyme activity of tissues was determined by cleavage of a 1-mM solution of BAEE (Sigma) in 10 mM Tris-HCl, pH 8.0, at 25 C after the addition of tissue homogenate (equivalent to 10–100 µg protein) to the assay cuvette. Cleavage of BAEE was determined by measuring the change in absorbance at 253 nm with a spectrophotometer (DU640B; Beckman Coulter, Fullerton, CA). Positive (normal canine prostate homogenate) and negative (normal canine muscle homogenate) controls were run in each assay. Activity was calculated as cleavage of moles of BAEE substrate per minute per mg protein. Activity assays were performed once, in triplicate. Results are expressed as percentages relative to activity in normal canine prostate, which was designated as 100%.
Results
Immunohistochemical evaluation of K7 expression by normal and neoplastic tissues
K7 expression was evaluated in eight nonneoplastic canine bladders (six normal and two with polypoid mucosal hyperplasia) and eight prostates (three normal, four with benign prostatic hyperplasia, and one with chronic prostatitis). Expression of K7 protein was moderate to marked in normal and hyperplastic bladder urothelium, especially in the superficial layers (Fig. 2). In the prostate glands, neither luminal nor basal epithelial cells of the normal prostatic acini expressed K7 (Fig. 1). Mild to moderate K7 expression was present in the periurethral gland ductular epithelium of five of five nonneoplastic prostate glands that contained ducts in the tissue sample (Fig. 1, inset).
Immunohistochemical evaluation of K7 expression was performed on 19 TCCs and 17 prostate carcinomas. The distribution and density of K7 expression was similar between the two tumor types (Fig. 7, panels A and B). Most of the TCCs had widespread, moderately to markedly intense cytoplasmic expression of K7. Only one TCC did not have K7 expression. Most of the prostate carcinomas also expressed moderate to high levels of K7.
Canine TCCs were composed of densely packed, moderately to markedly anaplastic epithelial cells arranged in solid, papillary, or cribriform patterns (Fig. 4). The cells often formed poorly arranged, highly cellular nests, acini, and tubules or cords, and proliferated in multiple layers. Most of the tumors were composed of a heterogenous cell population. The cell types ranged from a small polyhedral cell with a high N:C ratio; a round, hyperchromatic nucleus; and scant eosinophilic cytoplasm to large cells with low N:C ratios; abundant eosinophilic cytoplasm; and round to ovoid, vesicular nuclei. Highly vacuolated and signet-ring cells were commonly seen, and the vacuoles of these cells often contained a granular, basophilic material. Intratumoral and submucosal hemorrhage and edema were common. Most tumors also contained a mild to moderate amount of desmoplasia and lymphoplasmacytic inflammation.
K7 immunohistochemistry revealed that staining was most intense in the more superficial layers of the TCCs (as was found in the normal bladder), but staining was observed throughout the neoplasms (Fig. 6). Strong K7 expression was common in the more differentiated cells that resembled normal superficial bladder lining cells. K7 expression was especially strong in the large, highly vacuolated cells. Conversely, K7 expression was usually mild to moderate in the smaller polyhedral cells of the carcinomas. When present in the section, the superficial layers of the normal transitional epithelium adjacent to the tumor were uniformly K7 positive.
Most of the prostatic carcinomas (16 of 17) were of the “intra-alveolar” type and had a heterogenous histologic appearance (Fig. 3). These tumors were composed of numerous acini filled with neoplastic epithelial cells arranged in papillary to coalescing cords. The neoplastic cells contained large round to ovoid vesicular nuclei and multiple nucleoli. They had a small to moderate amount of eosinophilic cytoplasm, resulting in a relatively high N:C ratio. Most of the carcinomas also contained variable numbers of a distinct population of neoplastic epithelial cells with a morphology similar to TCC (Fig. 8). These cells were large and round, with a low N:C ratio and abundant granular, eosinophilic cytoplasm. They often contained large vacuoles with fine granular basophilic material similar to that present in vacuolated cells of TCCs. In many of the neoplastic alveoli, the small, typical prostate-like cells were found close to the basement membrane, whereas the larger, more vacuolated, urothelial-like cells were located toward the center of the alveolus. This pattern corresponded with what has been described as the “urothelial” pattern of canine prostatic carcinoma. Neoplastic alveoli throughout the neoplasm were usually well demarcated by intervening fibrosis, edema, and lymphocytic inflammation. There was a single case of small acinar prostatic carcinoma. This neoplasm was composed of numerous small, well-differentiated tubules distributed widely throughout the prostate parenchyma. There was marked desmoplasia, and numerous foci of lymphocytes and plasma cells were scattered throughout the gland.
K7 expression was evaluated in the prostatic carcinomas (Fig. 5). In the intra-alveolar tumors exhibiting K7 expression, the small polyhedral cells and the urothelial cells expressed similar amounts of the protein. Ducts and atrophied glands were mildly to moderately K7 positive in most of the tumors when these structures were presented for evaluation (seven of nine). The small acinar tumor exhibited only mild K7 expression in <33% of the cells.
Northern blot detection of AE messenger RNA in normal and neoplastic tissues
Northern blots demonstrated that normal canine prostate expressed a high level of AE messenger RNA (mRNA). A primary carcinoma expressed much less (10–15%) AE mRNA.
Nested reverse transcriptase–polymerase chain reaction detection of AE mRNA expression in normal and neoplastic tissues
Because of the small amounts of AE mRNA produced by prostatic carcinomas and the scarcity of fresh-frozen tissue samples, a nested reverse transcriptase-polymerase chain reaction (RT-PCR) protocol was developed for analyzing expression in formalin-fixed tissue sections. Tissue sections from two normal prostates, one normal urinary bladder, 13 prostate carcinomas, and 15 TCCs were analyzed for expression of AE mRNA. Normal prostate and bladder and all the prostate carcinomas, as well as most (13 of 15) of the TCCs expressed AE mRNA (Fig. 9). No positive reactions were detected on the first round of RT-PCR.
AE enzyme activity
Enzymatic activity of the canine serine protease, AE, was measured in five normal prostate glands and three bladders. Normal prostates had high levels (3.7 µmol/minute/mg protein) of AE activity, indicated by rapid and sustained cleavage of the synthetic substrate, BAEE (Figs. 10, 11). Low levels of AE activity were present in normal bladder tissue. AE activity was measured in two TCCs from female dogs. AE activity in these tumors was significantly less than in normal prostate and was very similar to that of normal bladder.
Fresh or frozen tissue was available from four prostate carcinomas, allowing both K7 expression and AE activity to be measured (Table 2). Carcinoma No. 1 was from a 10-year-old intact Great Dane. The dog had a large (approximately 6 cm in diameter) prostate that was firmly adherent to the periosteum of the pubic bone. The dog was euthanatized, and tissue samples were collected, but a complete necropsy was not permitted. However, gross inspection of the bladder mucosa did not reveal evidence of neoplasia. Histologically, this tumor was of the intra-alveolar type. The tumor was composed of numerous neoplastic glands filled with anaplastic epithelial cells. Neoplastic glands were often subdivided into lobules by connective tissue stroma. Many of the glands were markedly dilated and often contained a large amount of sloughed epithelial cells, neutrophils, and necrotic cell debris. Approximately 5–10% of the neoplastic epithelial cells had a urothelial morphology. Only a small amount of nonneoplastic prostate glandular epithelium was present, which was cystic and exhibited epithelial atrophy. Lymphoplasmacytic inflammation was present throughout the stromal cell compartment of the prostate. This carcinoma exhibited high levels of AE activity but did not express K7.
| Dog Nos. | Tumor Type | Keratin 7∗ (distribution/intensity) | AE† (% of normal) |
|---|---|---|---|
|
|
|||
| 1 | Intraalveolar | 0/0 | 70 |
| 2 | Intraalveolar | 3/3 | 150 |
| 3 | Intraalveolar | 1/1 | 1.6 |
| 4 | Intraalveolar | 2/2 | 4.4 |
|
|
|||
∗ K7 expression graded as percentage of tumor staining/intensity of staining.
† AE activity as a percentage of normal canine prostate.
Carcinoma No. 2 was from an 8-year-old castrated Labrador Retriever. A complete postmortem examination did not detect neoplasia in the bladder. This carcinoma was also predominately of the intra-alveolar type, but a higher percentage (approximately 30–40%) of the neoplastic cells exhibited a urothelial morphology. Marked desmoplasia was present. This carcinoma expressed K7 but also had high levels of AE activity. These results likely reflect the heterogenous histologic pattern often seen in canine prostate carcinomas, with both prostatic- and urothelial-like differentiation. Interestingly, many of the normal ducts of the prostate glands were highly K7 positive.
Carcinoma No. 3 was from a 7-year-old castrated mixed-breed dog. The tumor was present in the walls of a prostatic cyst that was surgically drained. Neither the bladder nor the inguinal lymph nodes contained any gross or histologic evidence of neoplasia. This carcinoma was also of the intra-alveolar type, with marked desmoplasia. Only a few neoplastic glands were present in the tissue section. The dog was eventually euthanatized, but a necropsy was not performed. Carcinoma No. 3 expressed K7 and had very low levels of AE activity.
Carcinoma No. 4 was from an 8-year-old castrated mixed-breed dog. The prostate and right iliac and sublumbar lymph nodes were enlarged and nodular. There was no evidence of neoplasia in the urinary bladder. Histologically, this carcinoma was also an intra-alveolar type. The carcinoma had metastasized to the lymph nodes. This carcinoma expressed moderate levels of K7 and had low levels of AE activity.
Discussion
The goal of this investigation was to develop specific immunohistochemical, biochemical, and molecular techniques to identify the cellular origin of canine prostate carcinomas. These markers could then be used to accurately distinguish prostatic neoplasms from neoplasms arising from the urothelium. The heterogenous histologic appearance of prostate carcinomas in dogs, coupled with the lack of a prostate-specific immunohistochemical marker suitable for canine tissues, led us to the conclusion that accurate classification of prostate carcinomas was not always possible with traditional light microscopic evaluation. In addition to variable results with PSA and PAP on canine tissues, the value of PAP for diagnosing prostatic carcinomas is questionable because PAP may also be expressed by urothelial carcinomas in humans.16 As chemotherapeutic protocols progress in veterinary oncology, it will become important to accurately classify canine prostatic carcinomas as being of prostate or urothelial origin or both. In humans, the etiology and prognoses of TCC and prostate carcinoma differ significantly.19
In this study we find that K7 expression was not able to discriminate between transitional cell and prostate carcinomas as we expected. We believe the similarities in K7 expression between the prostate and the TCCs have provided new insights into the origin of prostate cancer in dogs. The K7 expression patterns support a ductal origin of canine prostate carcinomas, as proposed by Leav et al.23 The periurethral ducts of the prostate develop as evaginations of the prostatic urethra. Both the prostatic urethra and the periurethral ducts express K7. Therefore, it would be expected for a prostatic carcinoma originating from periurethral ductular epithelium to exhibit K7 expression. However, the presence of AE mRNA and enzyme activity in some of the prostate carcinomas we examined suggests that in canine prostatic carcinomas the transformed ductal epithelial cells differentiated along multiple developmental programs (glandular, ductular, and transitional). It is likely that those prostate carcinomas with low levels of AE are of nonglandular origin. In this context, Leav et al21 demonstrated the presence of secretory granules in canine prostatic carcinomas that are characteristic of those found in normal glandular cells in this species. Interestingly, the existence of prostatic duct adenocarcinoma as a unique entity is controversial in human medicine6,35 and may represent an intermediate form between prostate carcinoma and TCC.27
Another explanation for the similarities in TCC and prostate carcinoma K7 expression may be the common embryologic origin of the bladder and the prostate.12 High-level expression of a urothelial marker like K7 by prostatic carcinomas may be an indicator of dedifferentiation of neoplastic prostatic epithelium to a less differentiated, urothelium-like tissue. Urothelial dedifferentiation or dual differentiation of prostatic carcinomas is supported by the heterogenous histopathology of the carcinomas. Many of the canine prostate tumors we evaluated contained areas resembling what Leav and Ling22 originally designated as the intra-alveolar morphology of canine prostate carcinomas. However, we also observed that many of these same tumors contained areas that were histologically very similar to that of TCC, what some have referred to as the urothelial pattern. It is interesting to speculate that dedifferentiation of prostate epithelium to a more primitive, developmentally immature urothelial morphology may be associated with an upregulation of genes associated with bladder differentiation in humans, such as PAX or H19.1,3 It is also possible that neoplasms arising in the canine prostate originate from invasive TCCs of the prostatic urethra and that K7 expression by these cancers is a reflection of their urothelial origin. Certainly, the fact that many of the dogs with prostate carcinoma (12 of 17) were castrated lends additional support to this hypothesis.
Although we expected to find AE expressed in normal and neoplastic prostatic tissues, it was surprising to identify AE mRNA and enzyme activity in normal canine bladder and TCCs. We were unaware of previous reports demonstrating AE mRNA or enzyme activity in normal or neoplastic canine urothelium. However, we realize that although the nested PCR technique we used is very sensitive, it is not quantitative and cannot be used to characterize neoplasms based on their AE expression level. The AE activity present in the normal bladder tissue may be due to the small amount of submucosal smooth muscle tissue present in the samples because AE mRNA expression has been reported in canine muscle tissue.7 Smooth muscle may also have contributed to the AE activity in the TCCs but is less likely as most of these samples were obtained from the mucosal surface of the bladder.
In conclusion, we have shown that the intermediate filament protein K7 was present in normal canine urothelium and prostate ductular but not secretory epithelium. K7 was expressed in a similar manner in canine transitional cell and prostate carcinomas. This finding may reflect either a ductal origin of canine prostate carcinoma or the dedifferentiation of prostate epithelial cells as they undergo neoplastic transformation. We also identified high levels of AE activity in normal prostates and some prostate cancers. Normal and neoplastic bladder and prostate tissues expressed AE mRNA. Surprisingly, normal and neoplastic bladder tissues had low levels of AE activity. Canine prostate carcinomas and TCCs have similar light microscopic and molecular characteristics, but AE activity levels may be useful for identifying prostate carcinomas with primarily glandular differentiation.
Acknowledgments
This work was supported by the U. S. Public Health Service, National Cancer Institute, and the National Center for Research Resources, Grants CA-77911 and RR-00168. B. E. LeRoy was supported by a T32 Oncology Training Grant (CA-09338, M. Caligiuri, Program Administrator). We thank Anne Saulsbery and Tim Vojt for excellent technical support.
References
1 Adshead JM, Ogden CW, Penny MA, Stuart ET, Kessling AM: The expression of PAX5 in human transitional cell carcinoma of the bladder: relationship with de-differentiation. BJU Int 83:1039–1044, 1999
2 Aumuller G, Seitz J, Lilja H, Abrahamsson PA, von der KH, Scheit KH: Species- and organ-specificity of secretory proteins derived from human prostate and seminal vesicles. The Prostate 17:31–40, 1990
3 Banet G, Bibi O, Matouk I, Ayesh S, Laster M, Kimber KM, Tykocinski M, de Groot N, Hochberg A, Ohana P: Characterization of human and mouse H19 regulatory sequences. Mol Biol Rep 27:157–165, 2000
4 Bassily NH, Vallorosi CJ, Akdas G, Montie JE, Rubin MA: Coordinate expression of cytokeratins 7 and 20 in prostate adenocarcinoma and bladder urothelial carcinoma. Am J Clin Pathol 113:383–388, 2000
5 Bell FW, Klausner JS, Hayden DW, Lund EM, Liebenstein BB, Feeney DA, Johnston SD, Shivers JL, Ewing CM, Isaacs WB: Evaluation of serum and seminal plasma markers in the diagnosis of canine prostatic disorders. J Vet Intern Med 9:149–153, 1995
6 Bock BJ, Bostwick DG: Does prostatic ductal adenocarcinoma exist? Am J Surg Pathol 23:781–785, 1999
7 Chapdelaine P, Gauthier E, Ho-Kim MA, Bissonnette L, Tremblay RR, Dube JY: Characterization and expression of the prostatic arginine esterase gene, a canine glandular kallikrein. DNA Cell Biol 10:49–59, 1991
8 Chu P, Wu E, Weiss LM: Cytokeratin 7 and cytokeratin 20 expression in epithelial neoplasms: a survey of 435 cases. Mod Pathol 13:962–972, 2000
9 Chu PG, Weiss LM: Keratin expression in human tissues and neoplasms. Histopathology 40:403–439, 2002
10 Clements JA: The glandular kallikrein family of enzymes: tissue-specific expression and hormonal regulation. Endocr Rev 10:393–419, 1989
11 Cornell KK, Bostwick DG, Cooley DM, Hall G, Harvey HJ, Hendrick MJ, Pauli BU, Render JA, Stoica G, Sweet DC, Waters DJ: Clinical and pathologic aspects of spontaneous canine prostate carcinoma: a retrospective analysis of 76 cases. The Prostate 45:173–183, 2000
12 Cunha GR, Donjacour AA, Hayward SW, Thomson AA, Marker PC, Abate-Shen C, Shen MM, Dahiya R: Cellular and molecular biology of prostatic development. In: Prostate Cancer: Principles and Practice, ed. Kantoff PW, Carroll PR, D'Amico AV, 1st ed., pp. 16–28. Lippincott Williams and Wilkins, Philadelphia, PA, 2002
13 De Marzo AM, Coffey DS, Nelson WG: New concepts in tissue specificity for prostate cancer and benign prostatic hyperplasia. Urology 53:29–39, 1999
14 Ding VD, Moller DE, Feeney WP, Didolkar V, Nakhla AM, Rhodes L, Rosner W, Smith RG: Sex hormone-binding globulin mediates prostate androgen receptor action via a novel signaling pathway. Endocrinology 139:213–218, 1998
15 Durham SK, Dietze AE: Prostatic adenocarcinoma with and without metastasis to bone in dogs. J Am Vet Med Assoc 188:1432–1436, 1986
16 Epstein JI, Kuhajda FP, Lieberman PH: Prostate-specific acid phosphatase immunoreactivity in adenocarcinomas of the urinary bladder. Hum Pathol 17:939–942, 1986
17 Espinosa de los MA, Fernandez A, Millan MY, Rodriguez F, Herraez P, Martin de las MJ: Coordinate expression of cytokeratins 7 and 20 in feline and canine carcinomas. Vet Pathol 36:179–190, 1999
18 Huggins CB, Clark PJ: Quantitative studies of prostatic secretion. 11. The effect of castration and of estrogen injection on the hyperplastic prostate glands of dogs. J Exp Med 72:747–750, 1940
19 Kantoff PW, Zeitman AL, Wishnow K, Oh WK, Hurwitz M, D'Amico AV, Richie JP: Neoplasms of the genitourinary tract. In: Cancer Medicine, ed. Bast RC, Kufe DW, Pollock RE, Weichselbaum RR, Holland JF, Frei E, 5th ed., pp. 1543–1589. BC Decker, Hamilton, Ontario, Canada, 2000
20 Kennedy PC, Cullen JM, Edwards JF, Goldschmidt MH, Larsen S, Munson L, Nielsen S: Histological Classification of Tumors of the Genital System of Domestic Animals. 2nd series, vol. 4, pp. 20–22. Armed Forces Institute of Pathology, Washington, DC, 1998
21 Leav I, Cavazos LF, Ofner P: Fine structure and C19-steroid metabolism of spontaneous adenocarcinoma of the canine prostate. J Natl Cancer Inst 52:789–804, 1974
22 Leav I, Ling GV: Adenocarcinoma of the canine prostate. Cancer 22:1329–1345, 1968
23 Leav I, Schelling KH, Adams JY, Merk FB, Alroy J: Role of canine basal cells in postnatal prostatic development, induction of hyperplasia, and sex hormone-stimulated growth; and the ductal origin of carcinoma. The Prostate 48:210–224, 2001
24 MacLachan NJ, Kennedy PC: Tumors of the genital system. In: Tumors in Domestic Animals, ed. Meuten DJ, 4th ed., p. 570. Iowa State University Press, Ames, IA, 2002
25 McEntee M, Isaacs W, Smith C: Adenocarcinoma of the canine prostate: immunohistochemical examination for secretory antigens. The Prostate 11:163–170, 1987
26 Moll R, Franke WW, Schiller DL, Geiger B, Krepler R: The catalog of human cytokeratins: patterns of expression in normal epithelia, tumors and cultured cells. Cell 31:11–24, 1982
27 Ohyama C, Takyu S, Yoshikawa K, Suzuki H, Tezuka F, Hasuda A, Inaba Y, Hoshi S, Orikasa S: Adenocarcinoma arising from the prostatic duct mimicking transitional cell carcinoma. Int J Urol 8:408–411, 2001
28 Osborn M, Weber K: Tumor diagnosis by intermediate filament typing: a novel tool for surgical pathology. Lab Invest 48:372–394, 1983
29 Stanford JL, Stephenson RA, Coyle LM, Cerhan J, Correa R, Eley JW, Gilliland F, Hankey B, Kolonel LN, Kosary C, Ross R, Severson R, West D: Prostate cancer trends 1973–1995, SEER Program, National Cancer Institute. NIH Pub. No. 99–4543:1999
30 Swinney GR: Prostatic neoplasia in five dogs. Aust Vet J 76:669–674, 1998
31 Taylor PA: Prostatic adenocarcinoma in a dog and a summary of ten cases. Can Vet J 14:162–166, 1973
32 Waters DJ, Bostwick DG: The canine prostate is a spontaneous model of intraepithelial neoplasia and prostate cancer progression. Anticancer Res 17:1467–1470, 1997
33 Waters DJ, Sakr WA, Hayden DW, Lang CM, McKinney L, Murphy GP, Radinsky R, Ramoner R, Richardson RC, Tindall DJ: Workgroup 4: spontaneous prostate carcinoma in dogs and nonhuman primates. The Prostate 36:64–67, 1998
34 Weaver AD: Fifteen cases of prostatic carcinoma in the dog. Vet Rec 109:71–75, 1981
35 Young RH, Srigley JR, Amin MB, Ulbright TM, Cubilla AL.: Tumors of the Prostate Gland, Seminal Vesicles, Male Urethra, and Penis. 3rd series, pp. 217–223. Armed Forces Institute of Pathology, Washington, DC, 2000
Cite article
Cite article
Cite article
OR
Download to reference manager
If you have citation software installed, you can download article citation data to the citation manager of your choice
Information, rights and permissions
Information
Published In
Article first published: March 2004
Issue published: March 2004
Keywords
PubMed: 15017026
Authors
Metrics and citations
Metrics
Article usage*
Total views and downloads: 2147
*Article usage tracking started in December 2016
Altmetric
See the impact this article is making through the number of times it’s been read, and the Altmetric Score.
Learn more about the Altmetric Scores
Articles citing this one
Receive email alerts when this article is cited
Web of Science: 39 view articles Opens in new tab
Crossref: 48
-
Reproductive
-
Canine Prostate Cancer: Current Treatments and the Role of Interventio...
-
Tissue S100/calgranulin expression and blood neutrophil-to-lymphocyte ...
-
Establishment of a BRAF V595E ‐mutant cani...
-
A Review on Canine and Feline Prostate Pathology
-
Histological and immunohistochemical investigation of canine prostate ...
-
An RNA-Seq-Based Framework for Characterizing Canine Prostate Cancer a...
-
Effects of the Latex of Synadenium grantii Hook F. (Euphorbiaceae) on ...
-
A Comparative Meta-Analysis and in silico Analysis of Differentially E...
-
Testes, Ovaries, and Prostate
-
Characterization of six canine prostate adenocarcinoma and three trans...
-
Prostatic Neoplasia in the Intact and Castrated Dog: How Dangerous is ...
-
Imaging and histopathological characteristics of carcinoma‐induced bon...
-
Tumors of the Male Reproductive System
-
Lower Urinary Tract Neoplasia
-
Outcome and prognostic factors in medically treated canine prostatic c...
-
Total prostatectomy as a treatment for prostatic carcinoma in 25 dogs
-
Reproductive
-
MicroRNA expression profiling in canine prostate cancer
-
Tumors of the Genital Systems
-
Tumors of the Urinary System
-
Genomic and proteomic profiling for cancer diagnosis in dogs
-
Reproductive System
-
Different Growth Patterns of Canine Prostatic Carcinoma Suggests Diffe...
-
Comparative Aspects of BRAF Mutations in Canine Cancers
-
Prostatic carcinoma in a dog: a new approach by using the Gleason syst...
-
Review of Animal Models of Prostate Cancer Bone Metastasis
-
All lesions great and small, part 2. Diagnostic cytology in veterinary...
-
Alterations of C-MYC, NKX3.1, and E-cadherin expression in canine pros...
-
Multiple joint metastasis of a transitional cell carcinoma in a dog
-
Tumors of the Male Reproductive System
-
Metastasis of a Prostatic Carcinoma along an Omental Graft in a Dog
-
Prostatic Disease
-
A specific molecular beacon probe for the detection of human prostate ...
-
Development of a brain metastatic canine prostate cancer cell line
-
Prostate cancer in dogs: Comparative and clinical aspects
-
The authors respond
-
Immunochemistry of prostatic carcinoma
-
Histopathological and immunohistochemical characterization of canine p...
-
Comparative characterization of the canine normal prostate in intact a...
-
Tumor Markers
-
A population study of neutering status as a risk factor for canine pro...
-
Regulation of COX‐2 Expression in Canine Prostate Carcinoma: Increased...
-
Protein expression profiling of normal and neoplastic canine prostate ...
-
Accessory Genital Glands
-
Heparin-binding proteins of canine seminal plasma
-
Prostate carcinomas and transitional cell carcinomas
Figures and tables
Figures & Media
Tables
View Options
View options
PDF/ePub
View PDF/ePubGet access
Access options
If you have access to journal content via a personal subscription, university, library, employer or society, select from the options below:
loading institutional access options
American College of Veterinary Pathologists members can access journal content using society membership credentials.
Alternatively, view purchase options below:
Purchase 24 hour online access to view and download content.
Access journal content via a DeepDyve subscription or find out more about this option.
