Elements essential for accumulation and function of small nucleolar RNAs directing site‐specific pseudouridylation of ribosomal RNAs

The H and ACA box‐containing snoRNAs are either synthesized from their own genes by pol II or are processed from longer RNA transcripts, such as pre‐mRNAs or polycistronic pre‐snoRNAs (see Introduction). The latter group of snoRNAs undergo exonucleolytic 5′ and 3′ end maturation, whereas the 5′ terminus of snoRNAs synthesized by pol II from independent genes is delineated by the polymerase itself and co‐transcriptionally acquires a 7‐methylguanosine cap structure that is modified later to 2,2,7‐trimethylguanosine (Maxwell and Fournier, 1995).

It has been demonstrated that elements directing the processing of human and yeast intron‐encoded H/ACA snoRNAs are located within the snoRNA sequence itself (Cecconi et al., 1995; Kiss and Filipowicz, 1995; Kiss et al., 1996; Ganot et al., 1997a,b). To assess whether box H/ACA snoRNAs that are synthesized by pol II from independent genes also possess the elements essential for processing from pre‐mRNA introns, a cDNA of the yeast snR5 snoRNA was inserted into the intron of the yeast actin gene that had been placed under the control of the promoter and terminator of the yeast alcohol dehydrogenase (ADH) gene (Figure 1A; Kiss‐László et al., 1996). The resulting ACT/SNR5 expression construct or the wild‐type SNR5 gene were inserted into the pFL45 yeast shuttle vector (Bonneaud et al., 1991) and transformed into the ΔsnR5 yeast strain that lacks a functional SNR5 locus (Ganot et al., 1997a). Northern analyses showed that, as expected, the ΔsnR5 cells transformed with the wild‐type SNR5 gene (Figure 1A, lane 3) accumulated the snR5 RNA at the levels of the control cells (Figure 1A, lane 1). However, in cells transformed with the ACT/SNR5 construct, no snR5 accumulation was observed (Figure 1A, lane 5). Since the actin mRNA was expressed correctly (data not shown), we concluded that the snR5 RNA lacks elements that are essential for RNA accumulation. In fact, the major difference between the wild‐type and the intronic snR5 RNA is that the latter lacks a 5′‐terminal cap, suggesting that the cap is crucial to the stability of snR5.

To investigate this assumption further, the snR5‐coding regions of the pFL45/SNR5 and the pFL45/ACT/SNR5 expression constructs were replaced with a cDNA of the yeast snR36 box H/ACA snoRNA that had been shown to be processed correctly from the yeast actin pre‐mRNA (Ganot et al., 1997a). The resulting pFL45/SNR36 and pFL45/ACT/SNR36 constructs were transformed into the ΔsnR36 yeast strain (Ganot et al., 1997a). Northern analysis showed that, either processed from the actin pre‐mRNA (Figure 1B, lane 1) or transcribed from the SNR5 promoter (lane 6), the snR36 was expressed efficiently. The differences in the levels of RNA accumulation probably reflect the fact that the SNR5 promoter supports transcription more efficiently than does the ADH promoter.

Integrity of the 3′‐terminal helical stem of box H/ACA snoRNAs is essential for RNA accumulation (Balakin et al., 1996). To test whether the 5′‐terminal stem is of similar importance, two mutant snR36 RNAs were constructed; snR36‐S1 and snR36‐S2, which contain two base substitutions in the 5′ stem (Figure 1B). When the mutant snR36 cDNAs were inserted into the pFL45/ACT intronic snoRNA expression construct and transformed into the ΔsnR36 strain, neither snR36‐S1 (Figure 1B, lane 3) nor snR36‐S2 (lane 4) was expressed. However, accumulation of the intron‐encoded snR36 was restored when the S1 and S2 base substitutions were combined to restore the base‐pairing of the 5′‐terminal stem (lane 5), indicating that integrity of this stem, rather than its nucleotide composition, is essential for snoRNA accumulation. Interestingly, both snR36‐S1 and snR36‐S2, as well as snR36‐S1+S2, were expressed under the control of the SNR5 promoter (Figure 1B, lanes 7–9). Immunoprecipitations with antibodies directed against the m³G cap demonstrated that all snR36 transcripts generated from the SNR5 promoter contained the 5′‐terminal m³G cap (data not shown). Collectively, our results demonstrate that the cap structure, most likely by protecting the 5′ end of the RNA, plays an important role in the accumulation of the wild‐type snR5 and the mutant snR36‐S1 and snR36‐S2 box H/ACA snoRNAs.

The H box was shown to be essential for the accumulation of intron‐encoded H/ACA snoRNAs (Ganot et al., 1997b). We tested whether this motif is also required for accumulation of box H/ACA snoRNAs which are transcribed from their independent genes. When the wild‐type H motif (AGACCA) of the yeast SNR5 was replaced with a mutant H box (gGgCCA) (Figure 1A), no snR5 accumulation was detected in the transformed ΔsnR5 strain (lane 4). This demonstrates that the H box is equally important for accumulation of both the intron‐borne and indepedently transcribed box H/ACA snoRNAs and that the 5′‐terminal cap structure cannot compensate the lack of an intact H box. The yeast snR36, like many other yeast H/ACA snoRNAs, carries a short stem–loop structure (IH1) inserted into the major 5′ hairpin domain (Figure 1B) (Ganot et al., 1997b). However, deletion of the IH1 element of the intron‐encoded snR36 (snR36‐ΔIH1) did not interfere with maturation of snR36 (Figure 1B, lane 2), indicating that the IH1 element does not contribute to the correct processing of the snoRNA.

In H/ACA snoRNAs that are processed from pre‐mRNAs or polycistronic pre‐snoRNAs, the 5′‐terminal stem is either followed by the H box immediately or they are separated by one or two nucleotides (Figure 2A). SnoRNAs that lack spacer nucleotides always carry one unpaired 5′‐terminal nucleotide, while snoRNAs with one or two spacer nucleotides feature two free 5′‐terminal nucleotides, suggesting that the position of the H box relative to the 5′‐terminal stem determines the 5′ terminus of the snoRNA. The snR36 possesses two potential H box motifs that are separated by one or two nucleotides from the 5′ stem (Figure 2A). Nevertheless, utilization of either one of these motifs is expected to result in two unpaired 5′‐terminal nucleotides. Wild‐type and mutant snR36 RNAs carrying H box motifs with altered positions (Figure 2A) were expressed in the ΔsnR36 strain and their 5′ termini were mapped by primer extension (Figure 2B). As expected, for the wild‐type snR36 and the mutant snR36‐H1 and snR36‐H2 RNAs in which the H box was placed unambiguously one or two nucleotides far from the 5′ stem, respectively, the major stop was observed at position U +1 (Figure 2B, lanes 2–4). However, when the H box was placed in the immediate vicinity of the 5′ stem (snR36‐H0), the major transcription stop identified the U +2 residue as the 5′‐terminal nucleotide (Figure 2B, lane 5). Northern analyses showed that the 3′ terminus of the U65‐H0 snoRNA was processed correctly (data not shown). This demonstrates that the H box, most likely in concert with the 5′‐terminal helix, delineates the correct 5′ terminus of box H/ACA snoRNAs that are processed from precursor RNAs.

The 5′ and 3′ hairpins of yeast snR34 and human U65 snoRNAs carry two pseudouridylation pockets that are predicted to direct pseudouridylation of yeast 25S and human 28S rRNAs at two equivalent positions, at Ψ2822/Ψ2876 and Ψ4374/Ψ4428, respectively (Ganot et al., 1997a; Ni et al., 1997) (Figure 3A). To test whether the human U65 can support pseudouridylation of yeast 25S rRNA, the U65 RNA was placed under the control of the SNR5 promoter and transformed into the ΔsnR34 yeast strain (Ni et al., 1997). Northern analysis of cellular RNAs isolated from the resulting U65 (Figure 3B, lane 4) and the control CMY133 and ΔsnR34 yeast strains (lanes 2–3), as well as from human HeLa cells (lane 1), showed that the human U65 snoRNA was expressed efficiently in yeast. Note that the 5′‐terminal region of U65 transcribed from the SNR5 promoter carries 11 leader nucleotides.

The state of pseudouridylation of the 25S rRNA was monitored by primer extension performed on CMC‐treated cellular RNAs. CMC reacts irreversibly with pseudouridines, and the modified pseudouridine‐CMC residue stops reverse transcriptase one nucleotide before the pseudouridylation site (Bakin and Ofengand, 1993). Predictably enough (Ganot et al., 1997a; Ni et al., 1997), disruption of the SNR34 locus abolished pseudouridylation of the 25S rRNA at Ψ2822 (Figure 3B, compare lanes 1 and 2) and Ψ2876 (compare lanes 4 and 5). However, expression of the human U65 RNA in the ΔsnR34 cells restored pseudouridylation of 25S rRNA at Ψ2822 (Figure 3B, lane 3) and Ψ2876 (lane 6). These results demonstrate that the U65 snoRNA represents the human orthologue of yeast snR34 and, more importantly, structural elements required for the function of pseudouridylation guide snoRNAs are conserved between humans and yeast.

Since the H and ACA boxes and the 5′‐ and 3′‐terminal helical stems are essential for accumulation of H/ACA snoRNAs, the function of these elements in the rRNA pseudouridylation reaction cannot be investigated directly by mutational analyses. Recently, we have shown that the human intron‐encoded U24 box C/D snoRNA, when expressed in yeast cells, is processed correctly and packaged into a functional snoRNP particle (Kiss‐László et al., 1998). Therefore, a U65/U24 fusion snoRNA was constructed and placed under the control of the SNR5 promoter (Figure 4A), anticipating that the U65/U24 transcript, even if carrying mutant U65 sequences, would be stable in yeast cells due to the presence of the 5′‐terminal cap structure and the 3′‐terminal U24 snoRNP particle. Indeed, Northern blot analyses of cellular RNAs obtained from the ΔsnR34 strain transformed with the pFL45/SNR/65/U24 construct showed that the U65/U24 snoRNA accumulated efficiently (Figure 4B, lane 2). Moreover, mapping of rRNA pseudouridylation demonstrated that expression of the U65/U24 snoRNA in the ΔsnR34 strain restored the wild‐type levels of pseudouridylation of yeast 25S rRNA at Ψ2822 (Figure 4C, lanes 1–3) and Ψ2876 (lanes 4–6). This demonstrates that the U65/U24 fusion snoRNA is not only stable but also functional in yeast cells.

The 5′‐terminal hairpin (5′hp) followed by the H box motif and the 3′‐terminal hairpin (3′hp) with the ACA box seem to represent two elements that are structurally and perhaps functionally equivalent. To test whether either of these domains can direct rRNA pseudouridylation independently, the 5′‐ or 3′‐terminal domain of the human U65 RNA, U65‐5′hp and U65‐3′hp, respectively, were fused to the U24 RNA and expressed in the ΔsnR34 strain (Figure 5A). Although the two chimeric RNAs accumulated efficiently, in contrast to the U65/U24 RNA (Figure 5B, lanes 3 and 8), neither U65‐5′hp/U24 (lanes 4 and 9) nor U65‐3′hp/U24 (lanes 5 and 10) could restore pseudouridylation of 25S rRNA at Ψ2822 or Ψ2876. This demonstrates that the presence of both the 5′hp and 3′hp is essential not only for snoRNA accumulation, but also for the rRNA pseudouridylation reaction.

In the rRNA–guide RNA interaction, the distance between the pseudouridylation site and the H or ACA box of the snoRNA shows a remarkable conservation. Normally, they are separated by 14 nucleotides (Ganot et al., 1997a; Ni et al., 1997). Alteration of the distance between the ACA box of the yeast snR8 and the target uridine residue resulted in either reduced pseudouridine synthesis at the correct site and/or partial modification of an adjacent uridine (Ni et al., 1997). To test directly the importance of the H and ACA boxes in the pseudouridylation reaction, the wild‐type H (AUAGUA) or ACA box sequences of the U65/U24 fusion snoRNA were replaced with the gggGgg and cCc mutant sequences, respectively (Figure 6A). The resulting U65‐H/U24 and U65‐ACA/U24 RNAs accumulated efficiently when expressed in the ΔsnR34 strain (Figure 6A, lanes 3 and 4).

The state of pseudouridylation of 25S rRNA derived from the control CMY133, the ΔsnR34, U65/U24, U65‐H/U24 and U65‐ACA/U24 strains was monitored by primer extension (Figure 6B). The U65‐H/U24 RNA that carried a mutant H box motif failed to direct pseudouridylation of the 25S rRNA at Ψ2822 and, to our surprise, also at Ψ2876 (Figure 6B, lane 9). Likewise, lack of an intact ACA box in the U65‐ACA/U24 RNA inhibited the pseudouridine synthesis at both Ψ2876 (Figure 6B, lane 10) and Ψ2822 (lane 5), demonstrating that the H and ACA boxes play equally important roles in the pseudouridylation reactions directed by both the 5′‐ and 3′‐terminal pseudouridylation pockets.

In the two hairpins of box H/ACA snoRNAs, the pseudouridylation pockets are always flanked by two well‐defined stem structures (Ganot et al., 1997b) (Figure 7A). While the stems at the bases of the 5′ and 3′ hairpins (stems B) are essential for snoRNA accumulation (Balakin et al., 1996; this study), helices above the pseudouridylation pockets (stems U) do not contribute significantly to the stability of the snoRNA (M.‐L.Bortolin, P.Ganot and T.Kiss, unpublished results). Nonetheless, we investigated whether the lower (B) and upper (U) helical stems flanking the 5′ and 3′ pseudouridylation pockets of the U65 snoRNA are essential for rRNA pseudouridylation. To this end, these stems were destroyed in the U65/U24 fusion snoRNA by substitution of the descending (3′ side) strands of each stem with non‐complementary sequences (d). In the next step, the base‐pairing for each helix was restored by substitution of the 5′ side of the stems with appropriate complementary sequences (r). Northern analysis demonstrated that upon transformation of the resulting pFL45/SNR/U65/U24 constructs into the ΔsnR34 strain, all the mutant U65/U24 snoRNAs were expressed.

We tested whether the mutant U65 snoRNAs can restore the pseudouridylation of 25S rRNA at Ψ2822 and Ψ2876 in the ΔsnR34 strain (Figure 7B). When the upper or lower stem in the 5′ hairpin of U65 was destroyed (U65‐5′Ud and U65‐5′Bd), pseudouridylation of 25S rRNA was abolished at Ψ2822 (Figure 7B, lanes 4 and 6) and, to our surprise, also at Ψ2876 (lanes 11 and 13). Restoration of these stem structures in the U65‐5′Ur and U65‐5′Br RNAs re‐established the pseudouridylation of 25S rRNA both at Ψ2822 (Figure 7B, lanes 5 and 7) and at Ψ2876 (lanes 12 and 14). Similar results were obtained upon mutation of the stem structures flanking the 3′ pseudouridylation pocket of U65. Disruption of either the upper (U65‐3′Ud) or the lower stem (U65‐3′Bd) had detrimental effects on pseudouridine formation at both Ψ2822 (Figure 7B, lanes 18 and 20) and Ψ2876 (lanes 25 and 27). When base‐pairing interactions were re‐established, the resulting U65‐3′Ur and U65‐3′Br RNAs restored pseudouridine formation at Ψ2822 (Figure 7B, lanes 19 and 21) and Ψ2876 (lanes 26 and 28). These observations demonstrate that the helical stems bracketing the 5′ and 3′ pseudouridylation pockets of box H/ACA snoRNAs are essential for the rRNA pseudouridylation reaction.

To select a ribosomal pseudouridylation site, two short sequence motifs in the pseudouridylation pocket of the guide RNA were proposed to form double helices with rRNA sequences that flank the substrate uridine (Ganot et al., 1997a). The importance of this interaction has been confirmed by showing that alteration of rRNA recognition motifs of the yeast snR36 and snR8 interferes with the rRNA pseudouridylation reactions directed by these snoRNAs (Ganot et al., 1997b; Ni et al., 1997). However, it remains unclear whether the two short rRNA recognition motifs provide all the information for selection of a unique pseudouridylation site in pre‐rRNA. To address this question, two slightly altered versions of the yeast snR36 pseudouridylation guide snoRNA, snR36‐m1 and snR36‐m2, were created (Figure 8A). The rRNA recognition motif of snR36 that directs the synthesis of Ψ1185 in the 18S rRNA (Ganot et al., 1997a) was substituted for sequences that, in principle, could select the U2871 residue in the 25S rRNA. The snR31‐m1 and snR36‐m2 RNAs carried identical recognition motifs except that the potential snoRNA–rRNA interaction region was extended by one base pair for the snR36‐m2 RNA. The wild‐type snR36 and the mutant snR36‐m1 and snR36‐m2 snoRNA were expressed from the SNR5 promoter in the ΔsnR36 strain (Figure 8A).

The state of pseudouridylation of 25S rRNA obtained from the control and ΔsnR36 strains as well as from the ΔsnR36 strain expressing either the wild‐type snR36 or the mutant snR36‐m1 or snR36‐m2 snoRNA was assayed (Figure 8B). Expression of the snR36‐m2 (Figure 8B, lane 1) and snR36‐m1 (lane 2) snoRNAs resulted in conversion of the U2871 residue into pseudouridine. Clearly, this pseudouridine was not detectable in the control (Figure 8B, lane 5), ΔsnR36 (lane 4) and snR36 (lane 3) strains. Contrary to expectations, the extended rRNA recognition motif of the snR36‐m2 snoRNA did not improve the efficiency of pseudouridine synthesis. However, as compared with a known pseudouridylation site in the yeast 25S rRNA at Ψ2861, it was apparent that the U2871 residue was converted into pseudouridine with only 40–50% efficacy. Similar results were obtained when another novel pseudouridylation site was introduced into the U2976 position of the yeast 25S rRNA (data not shown). Since snoRNA‐guided pseudouridylation sites are found in both helical and single‐stranded regions of rRNAs, it seems unlikely that the local structural environment of the substrate uridine would greatly alter the efficiency of the pseudouridine synthesis reaction (Ofengand et al., 1995; Ofengand and Bakin, 1997). We therefore propose that in the catalytic centre of these artificial snoRNPs, the substrate uridines occupy a suboptimal sterical position that impairs the isomerization reaction. It is also unlikely that additional, not yet identified snoRNA–rRNA interactions would contribute to the substrate recognition event. This conclusion is supported by the facts that, apart from the short rRNA recognition motifs in the pseudouridylation pockets, no obvious conservation can be found between the yeast snR34 and the human U65 snoRNAs and, more importantly, ribosomal target sequences as short as 12 nucleotides are pseudouridylated efficiently when expressed in the nucleolus (Ganot et al., 1997a). Hence, we conclude that the substrate specificity of the rRNA pseudouridylation reaction mediated by the box H/ACA snoRNAs is provided exclusively by the rRNA recognition motif of the snoRNA.

All procedures used for manipulating DNA, RNA and oligodeoxynucleotides were done according to standard laboratory techniques (Sambrook et al., 1989). The identity of all constructions was verified by sequence analyses. Growth and handling of Saccharomyces cerevisiae were done by standard techniques (Sherman, 1991). Construction of yeast strains ΔsnR5, ΔsnR34 and ΔsnR36 has been described (Ganot et al., 1997a; Ni et al., 1997). Expression plasmids were introduced into yeast cells using the lithium acetate transformation procedure (Ito et al., 1983). The following oligodeoxynucleotides were used in this study: (1) TATAAGCTTAATAGGAACTCATGGTG; (2) TATGGTACCTGATGGTTTTCTTATCCTGA; (3) TTTGGTACCTTTCTCGAGCTTCACTTCATTACTCTCTTGTTTAC; (4) TTTAGATCTATAATTGAAGTATATGTACG; (5) TTTGGTACCATCATTCAATAAACTGATC; (6) TTTCTCGAGATATGTACACCTAGAGCG; (7) TATGGTACCTTGCCCTGTGCCTCGCTCG; (8) TTACTCGAGTGATATGAGACGTTCTAATTA; (9) TTTGGTACCTTGAACTGTGCCTCGCTCG; (10) TATGTCGACGGGCTAAAACAATTAGACTTC; (11) AATTGTTTTAGAACGTTGATC; (12) CAACGGGCTAAAGCAATTAGACTTC; (13) CAACGG‐ GCTGAAACAATTAGACTTC; (14) CAACGGGCAAAGCAATTTAGACTTC; (15) GGCTGGAAGTGGGCCAATTTTTTTTGTTCC; (16) TTTGGTACCTCAGCCACCCGCCACTGC; (17) ATTCTCGAGCTGTTCCCATGCTTTCGG; (18) CCGCTCGAGATGCGGCTTACTGTGCAGATGATGTAAAAG; (19) TTCCGCGGCCGCTATGGCCGA‐ CGTCGACTGCAGTGCATCAGCGATCTTGG; (20) ATAGACATATGGAGGCGTG; (21) CCAGCTCAAGATCGTAATAT; (22) GTTATTACATCATTTGA; (23) CCGCTCGAGCGGGTCCCATGCTTTCG; (24) ATGCTTTCGGCACAGAGTCATCC.

Construction of yeast expression vectors pFL45/SNR5 and pFL45/ACT has been described (Ganot et al., 1997a). Construction of many plasmids relied on PCR amplification reactions. For each amplification reaction, hereafter, the 5′ end‐specific primer is indicated first and it is followed by the 3′ end‐specific primer. The pFL45/SNR expression cassette was obtained as follows. The promoter (oligos 1 and 2) and terminator (oligos 3 and 4) regions of the yeast SNR5 gene were PCR amplified and, after HindIII–KpnI and KpnI–BglII digestions, respectively, were ligated and inserted into the HindIII and BamHI sites of pFL45. To obtain pFL45/ACT/SNR5, pFL45/ACT/SNR36 and pFL45/SNR36, the cDNAs of snR5 and snR36 were PCR amplified using oligos 5 and 6 or oligos 7 and 8, respectively. The amplified fragments were digested by KpnI–XhoI and inserted into the same sites of pFL/45/ACT and pFL45/SNR. The same approach was used to construct pFL45/SNR36‐S1, except that a mutagenic 5′ end‐specific primer (oligo 9) that contained appropriate base changes was used. To create pFL45/ACT/SNR36‐ΔIH1, the 5′ (oligos 7 and 9) and 3′ (oligos 10 and 8) halves of snR36 were amplified, religated using the PCR‐introduced SalI site and inserted into the KpnI and XhoI sites of pFL45/ACT.

Construction of cDNAs of snR36 or snR5 carrying altered H box motifs or 5′ stem sequences was achieved by the megaprimer amplification approach (Datta, 1995). To obtain snR36‐S2 and snR36‐S1+S2 cDNAs, the 5′‐terminal region of snR36 was amplified using primers 7 and 11 or 9 and 11, respectively. In the second amplification step, the resulting fragments were used as megaprimers in combination with a common 3′ end‐specific primer (oligo 8). The mutant snR36 cDNAs were inserted into the KpnI–XhoI sites of pFL45/ACT and pFL45/SNR, resulting in pFL45/ACT/SNR36‐S2, pFL45/ACT/SNR36‐S1+S2, pFL45/SNR36‐S2 and pFL45/SNR36‐S1+S2. To create snR36‐H1, snR36‐H2 and snR36‐H0 cDNAs, megaprimers encompassing the 3′ half of snR36 were generated by using oligos 12, 13 and 14 as 5′‐specific primers that carried altered H box motifs, respectively, and a common 3′ end‐specific primer (oligo 8). In the second amplification reaction, a common 5′‐specific primer (oligo 7) was used with the mutant megaprimers. The amplified cDNAs were inserted into the KpnI–XhoI sites of pFL45/ACT. To obtain pFL45/SNR5‐H, using oligos 15 and 4 and the pFL45/SNR5 plasmid as a template, the 3′ half of the SNR5 gene was amplified and used as a megaprimer with oligo 1 in the second amplification reaction. The resulting snR5‐H cDNA was digested by HindIII and BglII and inserted into the HindIII and BamHI sites of pFL45.

To generate pFL45/SNR/U65, the human U65 snoRNA was PCR amplified using oligos 16 and 17, cut with KpnI and XhoI and inserted into the same sites of pFL45/SNR. The cDNA of human U24 snoRNA was amplified (oligos 18 and 19), digested with XhoI and SalI and cloned into the XhoI site of pFL45/SNR/U65, resulting in pFL45/SNR/U65/U24.

A series of mutant U65 cDNAs, U65‐5′hp, U65‐3′hp, U65‐H, U65‐ACA, U65‐5′Ud, U65‐5′Ur, U65‐5′Bd, U65‐5′Br, U65‐3′Ud, U65‐3′Ur, U65‐3′Bd and U65‐3′Br (Figures 5, 6 and 7), were constructed by PCR amplification using appropriate mutagenic oligonucleotides in combination with either a common 5′ end‐ (oligo 16) or 3′ end‐specific primer (oligo 17). Structures of the mutagenic oligonucleotides are available upon request. The amplified cDNAs were digested with KpnI and XhoI and were used to replace the wild‐type U65 RNA sequences in pFL45/SNR/U65/U24.

Yeast cellular RNAs were isolated by the guanidine thiocyanate/phenol–chloroform extraction method (Tollervey and Mattaj, 1987). For Northern analyses, if not stated otherwise, 10 μg of cellular RNAs were separated on a 6% sequencing gel, electroblotted onto a Hybond‐N nylon membrane (Amersham) and probed with kinase‐labelled oligonucleotides complementary to yeast snR5 (oligo 20), snR36 (oligo 21), U24 (oligo 22), and to either the 5′‐ (oligo 23) or 3′‐terminal (oligo 24) sequences of human U65. Primer extension mapping of the 5′ terminus of snR36 RNA was performed using 5′ end‐labelled oligo 21 and 10 μg of yeast cellular RNAs. Mapping of pseudouridine residues at positions 2822 and 2876 in the yeast 25S rRNA was performed by primer extension analyses of CMC‐alkali‐treated yeast cellular RNAs as described earlier (Bakin and Ofengand, 1993; Ganot et al., 1997). Primer extension products were analysed on 6% sequencing gels.