RNA silencing, also referred to as RNA interference and posttranscriptional gene silencing, is an evolutionarily conserved mechanism that protects cells against invasive nucleic acids, such as viruses, transposons, and transgenes (
19). RNA silencing is triggered by double-stranded RNA (dsRNA), effects sequence-specific degradation of cognate viral or endogenous RNA, and, at least in plants, causes de novo methylation of homologous DNA (
33). In plants, silencing is increasingly viewed as an adaptive immune system targeting pathogenic RNA and DNA (
28,
52). To counteract this defense system, viruses have evolved suppressor proteins (
4,
6,
37) that interfere with different steps of the RNA silencing pathway (
11), thus allowing efficient viral replication in a single cell and systemic spread of the infection. For example, the coat protein of
Turnip crinkle virus blocks generation of small interfering RNAs (siRNAs) (
38), derived from dsRNA processing by the RNase III-like enzyme Dicer at an early initiation step of silencing. p19 of tombusviruses binds siRNAs (
27,
51), thereby inhibiting a downstream step involving cleavage of cognate RNA by an siRNA-guided, RNA-induced silencing complex. Movement protein P25 of
Potato virus X prevents systemic spread of silencing through the vascular system (
54). Potyvirus protein HC-Pro might interfere with both the initiation and spread of silencing, although the mechanism of HC-Pro action is still a matter of debate (reference
32 and references therein). Interestingly, HC-Pro and other viral suppressors not only are able to suppress RNA silencing but also can interfere with a related micro-RNA (miRNA) pathway (
8,
11,
24,
31) that plays a pivotal role in plant and animal development (
3,
7). In plants, the miRNA pathway is similar to RNA silencing in that miRNA precursors are also cleaved by the Dicer-like enzyme DCL1, but the latter is localized in the nucleus (
34). It is intriguing that
Cucumber mosaic virus, a cytoplasmic RNA virus, codes for a nuclear protein (2b) that suppresses RNA silencing (
8,
30) and also interferes with RNA-directed DNA methylation (
14).
Thus, viruses seem to exploit various mechanisms of silencing suppression by deploying their specialized proteins to different compartments of the cell. In this paper, we propose a new mechanism of silencing suppression in which a viral, nucleus-targeted protein acts indirectly by activating transcription of host silencing suppressor gene(s).
We are studying the bipartite geminivirus
Mungbean yellow mosaic virus-Vigna (MYMV) (
23) with the goal of generating resistance to the virus by using an RNAi-based strategy (
35). Geminiviruses are small, circular, single-stranded DNA viruses that replicate in the nucleus of an infected cell via double-stranded intermediates that also serve as templates for bidirectional transcription (
15,
18). Bipartite geminiviruses of the genus
Begomovirus express the small protein AC2 (also called AL2 or TrAP), which transactivates transcription of late viral genes (
44,
16). Consistent with its function as a transcriptional activator, three conserved domains have been recognized in this protein: a basic domain with a nuclear localization signal (NLS) at the N terminus, a central DNA-binding domain with a nonclassical Zn-finger motif, and an acidic activator domain at the C terminus (
21). Studies on AC2 of
African cassava mosaic virus (ACMV) and the homologous C2 of
Tomato yellow leaf curl virus-China (TYLCCNV), a related monopartite begomovirus, have implicated these proteins in suppression of RNA silencing (
10,
17,
50,
53). Notably, TYLCCN C2 requires functional NLS and Zn-finger domains to suppress silencing (
10,
50). In this work, we found that AC2 from MYMV serves as a transactivator of viral promoter and as a suppressor of RNA silencing. These two functions could not be separated by mutations in the three conserved domains including the activator domain, suggesting that suppression of silencing by AC2 might involve activation of transcription of an endogenous silencing suppressor gene(s). By RNA profiling with Affymetrix GeneChips (ATH1) and transient expression assays with
Arabidopsis protoplasts, we identified several candidate suppressor genes, whose promoters were dramatically induced in response to AC2 from MYMV and its homologue from ACMV.
MATERIALS AND METHODS
Plasmid construction.
MYMV bidirectional promoter chloramphenicol acetyltransferase (CAT) constructs were generated by replacing the cauliflower mosaic virus 35S promoter and leader sequences between the AflIII and NcoI sites of pKS
XAHA (
36) with a PCR-amplified, 263-bp segment of MYMV DNA A (accession no. AJ132575 ), spanning from the AC1 ATG start codon (at position 2609) to the AV2 ATG (at position 141), yielding pAC1AV2CAT (Fig.
1). The AC2 coding region from MYMV (positions 1623 to 1216) was introduced by PCR between the XhoI and SphI sites of pKS
XAHA in place of CAT, yielding p35SAC2 (Fig.
1). The following PCR primers were used: 5′TTGTG
CTCGAGaaaga
atgcggaattctacaccctc (XhoI and AC2 start codon underlined; viral nucleotides in lowercase) and 5′ATTTA
GCATGCtca
ctaaaagtcgataatatcatcccag (SphI and AC2 stop codon underlined). To create a deletion of the AC2 activator domain (AD
−), the former primer was used along with 5′gcagt
gcAtGc
ttAaacccgtggttgaacattatc (with SphI and a new stop codon underlined). Point mutations NLS1
−, NLS2
−, and ZF
− were introduced by PCR ligation, using the following pairs of primers containing the respective mutations: 5′caaggttgccGCAGCCGCagcaattcgacgctctcgaattgat and 5′cgaattgctGCGGCTGCggcaaccttgtgttgcgcct, 5′gcgagcaattGCaGCctctGCaattgatttaagctgtgggtgtag and 5′taaatcaattGCagagGCtGCaattgctcgcttcttggcaaccttgtg, and 5′cgaattgatttaagcGCtgggGCtagttattacatccatatcaactgc and 5′ggatgtaataactaGCcccaGCgcttaaatcaattcgagagcgtc.
The 35S promoter-driven expression cassettes for MYMV proteins AC1 (positions 2611 to 1523; GenBank accession number AJ132575 ), AC3 (1475 to 1071), AC4 (2460 to 2161), and BC1 (2117 to 1221; GenBank accession number AJ132574 ) and for ACMV-KE AC2 (1771 to 1364; GenBank accession number NC_001467 ) were also constructed by replacing CAT between XhoI and SphI of KSXAHA with the respective coding sequences.
To create GFP::ChS::AC2 protein fusions, the wild-type and mutant versions of AC2 were introduced between MluI and XbaI of pEGFPChS: the PCR primer 5′GAGAAACGCGTcggaattctacaccctcaag (MluI underlined, followed by AC2 from the second codon) was used together with either 5′GATTTTCTAGAGCATGCtcactaaaagtcgataatatcatcc (XbaI and AC2 stop codon underlined) or 5′GATTTTCTAGAGCATGCttAaaccccgtggttgaac (XbaI and AD− stop codon underlined).
Particle bombardment of plant seedlings.
Nicotiana benthamiana plants were raised from seeds of the mGFP5ER transgenic line 16c (
39); kindly provided by D. Baulcombe) either on agar-solidified Murashige and Skoog medium or in soil at 26°C with 16-h day and 8-h night. Three to four weeks postgermination, seedlings were bombarded using a biolistic particle delivery system (PDS-1000/He; Bio-Rad) with 1-μm gold particles coated with plasmid DNA. For one plate/pot with four to eight seedlings, 2 μg of trigger plasmid p35SmGFP5ER (
26) alone or in combination with 2 μg of suppressor plasmid (p35AC2 or its derivatives) was loaded on 750 μg of gold particles and delivered at 1,100 lb/in
2, following the manufacturer's recommendations. After bombardment, plants were maintained in a nonstop-light chamber at 26°C. Images of silencing under UV light (100-W longwave mercury spot lamp; OmniLab AG) were taken with a digital camera.
Arabidopsis protoplast preparation.
An Arabidopsis thaliana La-er cell suspension (kindly provided by T. Boller, Institute of Botany, Basel, Switzerland) was maintained in AT medium (4.43 g of Murashige and Skoog basal salts/liter with minimal organics [Sigma], 3% sucrose, 5.4 μM naphthalene acetic acid, 0.23 μM 6-furfurylaminopurine [pH 5.6]) at 25°C and 130 rpm with a 16-h day. Protoplasts were prepared from 50 ml of suspension 1 week after subculturing (1:10) as follows. Cells were harvested by centrifugation (Jouan B4; IG Instrumenten, Zürich, Switzerland) for 2 min at 800 rpm, washed with 0.5 M mannitol (pH 5.8), and transferred to 70 ml of enzyme solution (1% cellulase Onozuka R-10, 0.25% macerozym R-10, 0.5 M mannitol, 10 mM CaCl2 [pH to 5.6]). Following incubation for 16 to 18 h at 26 to 28°C in the dark, protoplasts were filtered through a 100-μm-pore-size sieve, diluted with equal volume of W5 (150 mM NaCl, 5 mM KCl, 125 mM CaCl2, 6 mM glucose [pH 5.6]), and pelleted for 5 min at 1,000 rpm. Cells were resuspended in 10 ml of 0.6 M sucrose-1% morpholineethanesulfonic acid (pH 5.6) and carefully overlaid with 1 ml of W5. Following centrifugation for 10 min at 800 rpm, cells were harvested from the interphase and washed with 10 ml of W5 twice by inverting the tube and spinning for 3 min at 800 rpm; during the second washing, cells were incubated in W5 for 10 to 30 min. Protoplasts were resuspended in 5 ml of MMM (0.5 M mannitol, 0.1% morpholineethanesulfonic acid, 15 mM MgCl2 [pH 5.6]), counted, and adjusted to a density of 2 × 106/ml.
RNA profiling with Arabidopsis protoplasts.
Three-hundred-microliter aliquots (6 × 105 protoplasts), in six replicates for each construct, were mixed with 20 μg of plasmid and incubated for 5 min at room temperature (RT). Three hundred microliters of 40% polyethylene glycol (PEG) 4000 was added, and the contents were mixed and incubated for 20 min at RT and transferred into 4 ml of CMA medium (see the supplemental material). Following incubation for 8 h at 28°C in the dark, protoplasts were diluted with 10 ml of W5 and pelleted for 10 min at 1,000 rpm. The pellets of two replicates were combined (∼80 μl), 800 μl of TRIZOL (GibcoBRL) was added, and the mixture was incubated for 5 min at RT. Protein was extracted with 160 μl of chloroform by vortex mixing and incubation for 3 min at RT followed by centrifugation for 10 min at 13,000 rpm and 4°C. The aqueous phase (∼600 μl) was taken, and total RNA was precipitated by addition of 500 μl of isopropanol for 45 min at RT and pelleted for 15 min at 13,000 rpm and 4°C. The pellet was washed with 75% ethanol, dried in a SpeedVac, and dissolved in 100 μl of sterile bidistilled water. Further purification was performed with an RNeasy Plant minikit (QIAGEN), following the manufacturer's recommendations. The total yield of RNA from the six replicates ranged from 35 to 100 μg.
For each construct, as well as a control mock transfection, two 10-μg total RNA samples derived from two independent batches of Arabidopsis protoplasts were processed for microarray analyses according to the protocol recommended by Affymetrix. Ten micrograms of fragmented cRNA was hybridized to an ATH1 GeneChip (Affymetrix) using standard procedures (45°C, 16 h). Washing and staining were performed in a Fluidics Station 400, using the protocol EukGE-WS2v4, and scanning was carried out with an Affymetrix GeneChip scanner. Analysis of the chips was performed using MicroArraySuite 5 and GeneSpring 5.0 (Silicon Genetics). Changes in gene expression were determined, requiring that a gene was called “present” in one or more conditions and had a Wilcoxon change P value of <0.003 for “increase” or “decrease” in all replicate comparisons. Significance of the changes was assessed in the following ways: the genes passing the expression and severalfold-change filters were subjected to a one-way analysis of variance (P < 0.05) with a Benjamini and Hochberg multiple testing correction. The origin of the differences indicated by the analysis of variance were probed with a Tukey posthoc analysis.
Transient expression in plant protoplasts.
A. thaliana protoplasts were prepared and transfected as described above. Transient expression in
Nicotiana plumbaginifolia leaf protoplasts was carried out as described previously (
9). A 300-μl protoplast aliquot (6 × 10
5) was mixed with up to 30 μl of plasmid DNA mixture containing 10 μg of CAT plasmid, 10 μg of viral protein expression plasmid (e.g., AC2 or its derivatives), and 2 μg of β-glucuronidase (GUS) plasmid as an internal control of transfection efficiency. Three hundred microliters of 40% PEG 4000 (
A. thaliana) or PEG 6000 (
N. plumbaginifolia) was added, and the mixture was incubated for 10 to 30 min at RT and transferred to 4 ml of CMA (
A. thaliana) or K3 (
N. plumbaginifolia) medium (see the supplemental material). Following incubation for 19 to 24 h at 28°C in the dark, protoplasts were diluted with 10 ml of W5 and pelleted for 10 min at 1,000 rpm. The pellet was diluted with water to a final volume of 90 μl, and 10 μl of 10× GUS buffer (0.5 M NaH
2PO
4, 0.1 M EDTA, 1% Triton X-100, 1% C
15H
28NNaO
3 [pH 7.0]) was added. The cells were broken by three cycles of freezing in liquid nitrogen and thawing at 37°C. Total protein extract was cleared by centrifugation for 10 min at 15,300 rpm, 4°C. CAT protein accumulation was determined in 30 μl of extract by using a CAT enzyme-linked immunosorbent assay kit (Roche), following the manufacturer's recommendations; GUS activity was determined by a fluorimetric GUS assay (
36). Relative GUS activities were taken for normalization of CAT expression levels. For each construct, the values given are the means from at least three independent batches of protoplasts. Deviations from the mean values did not exceed 30%.
Visualization of GFP in plant protoplasts.
N. plumbaginifolia protoplasts were prepared and transfected with 20 μg of plasmid DNA of pEGFPChS or its derivatives as described in the previous section. Twelve hours posttransfection, 500-μl aliquots were mixed with 500 μl of fixation solution (6% paraformaldehyde in phosphate-buffered saline [pH 7.4], 10 mM EGTA) and incubated for 30 min at RT. One hundred fifty- to two hundred-microliter aliquots were applied onto polylysine-coated slides, centrifuged (Cytospin3; Shandon) for 3 min at 1,000 rpm, and air dried for 30 min. Two drops of DAPI-DABCO (Vectashield Hard+Set mounting medium with 1.5 μg of 4′,6′-diamidino-2-phenylindole [DAPI]/ml; Vector Laboratories) was added. Slides were covered with thin glass coverslips and kept for 10 h at 4°C. Fluorescence microscopy was performed with a Nikon Eclipse E800 microscope equipped with Plan Apochromat objectives (Nikon, Tokyo, Japan). Filter set XF100 with excitation at 475 ± 40 nm and emission at 520 ± 30 nm (Omega Optical, Brattleboro, Vt.) was used for visualization of green fluorescent protein (GFP). Protoplasts were visualized by using ×60 oil immersion lens. Images were acquired and processed with an ORCA-100 progressive-scan interline charge-coupled-device camera (Hamamatsu Photonics, Hamamatsu City, Japan) and Openlab 3 software (Improvision, Coventry, United Kingdom).
Cloning of AC2-inducible gene promoters from Arabidopsis.
Genomic DNA from the Columbia (Col-0) ecotype of
Arabidopsis was used for PCR amplification of AC2-inducible gene sequences. Primer design was based on the complete genome of Col-0 (The Arabidopsis Information Resource database at www.arabidopsis.org ). The promoter regions of about 800 to 1,100 bp upstream of the first ATG start codon of each gene (supplemental Table S4) were introduced between AflIII and NcoI of pKS
XAHA (
36), thus directly fusing the CAT coding sequence to the first ATG.
DISCUSSION
Viral suppression of silencing is usually exerted as a secondary function of ordinary viral proteins, e.g., coat protein, movement protein, and protease, which themselves have little in common. This suggests that protein domains responsible for the suppressor activity are, most likely, different from those involved in the primary functions of the viral proteins, although RNA binding has been proposed as a common theme (
42).
In begomoviruses, silencing suppression is also a secondary function of the viral transcription activator AC2, but, unexpectedly, in this work we could not separate the two functions of AC2 as viral transcription factor and silencing suppressor by mutagenesis, albeit with a limited number of mutations. This suggests that the suppressor activity is causally coupled to the transcription factor activity.
Silencing suppression through transactivation of other viral genes by AC2 can be excluded, because AC2 acts as a suppressor in a model system in the absence of virus infection, and other MYMV proteins showed no suppressor activity when tested individually.
MYMV AC2 possesses three domains typical of transcription activators: a bipartite NLS, a nonclassical Zn finger, and an acidic activator domain (
21; this work). All three of these features are conserved in other begomoviruses. Here we report that these domains in combination are required for both promoter activation and silencing suppression. The fact that the cytoplasmic AC2 variant with mutated NLS (NLS1
−) failed to suppress silencing argues for an indirect effect of AC2, because GFP silencing in our model system is most likely a cytoplasm-based mechanism of RNA destruction. Furthermore, the nuclear AC2 requires intact Zn-finger and activator domains to suppress silencing, suggesting that transcription activation of a host suppressor(s) might be involved. Indeed, the loss of suppressor activity of the ZF
− and AD
− mutants correlates with their failure to induce host genes.
In line with our results, in the case of TYLCCNV C2, a functional NLS and a Zn finger are both required for suppression of RNA silencing (
10,
50). However, C2-mediated activation of viral transcription has not been reported for this or other monopartite begomoviruses. Since C2 from the latter genus also possesses a conserved acidic domain at the C terminus, a similar mechanism of silencing suppression via transcription activation of host genes can be proposed.
It has been demonstrated that the AC2 homologue from
Tomato golden mosaic virus (TGMV AL2) transactivates late viral genes at the level of transcription (
44). However, the molecular mechanism of AC2-mediated transactivation is largely unknown. Attempts to identify any conserved AC2-responsive
cis element have met with little success (
40,
47). Moreover, sequence-nonspecific and weak binding to double-stranded DNA in vitro (
21,
43) suggests that AC2 may rather engage (through its Zn finger) in interaction with one or more cellular factors, which would in turn target it to different promoters.
Recently it has been shown that TGMV AL2 interacts with two cellular proteins, serine/threonine kinase (SNF1) (
20) and adenosine kinase (ADK) (
55). The first interaction, which is mediated by the AL2 Zn-finger domain, inactivates SNF1 kinase, the key regulator of cell metabolism implicated in the innate antiviral defense, and thereby leads to enhanced susceptibility to infection with DNA and RNA viruses (
20,
46). The second interaction inactivates ADK, which may serve as an early activator of SNF1, thus suggesting a dual counter-defensive strategy evolved by geminiviruses to cope with the innate antiviral response (
55). It has also been speculated that inactivation of ADK by AL2 may indirectly suppress silencing by interfering with a general methylation pathway that requires ADK (
55). Because these two interactions and their effects most likely occur in the cytoplasm and do not require the AL2 transcription activator domain (
20,
46,
55), they cannot account for transcription activation of the viral and host genes observed by us. Moreover, suppression of RNA silencing correlates with the nuclear localization of the suppressor proteins TLCCNV C2 (
10) and MYMV AC2 (this work) and, in the case of MYMV AC2, requires the transcription activator domain (this work). However, formally we cannot exclude that possible interference with the innate antiviral response by MYMV AC2 may partly contribute to the strong antisilencing effect observed in our experimental system.
Activator domains are believed to enhance transcription by recruiting components of the basal transcriptional machinery (
49). In fact, the TGMV AL2 activator domain was able to functionally replace the corresponding domain of the transcriptional activator GAL4 in yeast and human cells (
21). Interestingly, attempts to produce transgenic plants constitutively expressing full-length AC2/AL2 proteins have failed, possibly because of toxicity of those proteins, while plants expressing a truncated form of TGMV AL2 lacking the activator domain could be recovered (
46). The dramatic changes in the plant transcriptome in response to wild-type AC2 from both MYMV and ACMV described here might help explain those earlier observations. In particular, constitutive up-regulation of endogenous silencing suppressor(s) by AC2 might interfere with normal plant development.
As hypothesized above, host genes involved in silencing suppression might become activated by AC2. Alternatively, to achieve silencing suppression, AC2 may repress genes that are positively involved in the silencing process. Our RNA profiling approach with
Arabidopsis protoplasts demonstrates that upon transient expression of wild-type AC2, no dramatic reductions in RNA levels could be detected. This makes transcriptional repression of genes involved in the silencing pathway unlikely, although some of such genes might be missing from the ATH1 chip. On the other hand, RNA profiling revealed a set of genes whose transcripts are elevated considerably in the presence of AC2 from two different begomoviruses, raising the possibility that some of these code for silencing suppressors. An increase in the RNA level could result from either RNA stabilization or activation of transcription. For several selected AC2-inducible genes, we found that the promoter regions cloned from the
Arabidopsis genome were highly active only in the presence of AC2 (Table
2), suggesting that the increase in the corresponding RNA levels observed on the chips was due to transcriptional activation.
The promoter sequences tested here include 5′-untranslated regions (UTRs), which often possess important elements regulating transcription (reference
22 and references therein). Such a region may therefore contain (part of) an AC2-responsive element, and formally we cannot exclude that the latter is an RNA-based element. However, we do not favor a scenario in which these 5′-UTR sequences contain any RNA instability determinants that would normally occur either in 3′-UTR or in coding sequence of unstable RNAs.
While the annotations available for most of the AC2-inducible genes give little clue as to whether and how they could exert suppressor functions, at least two such genes, At5g15960 and At3g12460, can be viewed as realistic candidates.
At5g15960 codes for the cold- and abscisic acid-inducible protein KIN1. Interestingly, five additional known or putative cold-regulated genes were also up-regulated by AC2 (supplemental Table S2). It has been reported that low temperatures inhibit RNA silencing (
48). One could imagine the existence of a general mechanism limiting silencing at low temperatures and that this mechanism is exploited by AC2 in order to suppress virus silencing.
At3g12460 codes for a hypothetical protein of 242 amino acids with homology to a 3′-5′ exonuclease domain of the Werner syndrome protein, implicated in premature aging in humans (
41). Interestingly, in
Caenorhabditis elegans and
Arabidopsis, genes for Werner-like exonuclease proteins MUT-7 and WEX, respectively, have been identified as positive regulators of RNA silencing (
13,
25). Our PSI-BLAST analysis showed that the conserved “DEDDy” signature of Werner-like exonucleases (
56) is only partially preserved in the hypothetical WEX-like protein identified by us (hereafter called WEL-1 for Werner exonuclease-like 1). Thus, WEL-1 might exert a dominant-negative effect by interfering with an as yet unknown function of WEX in RNA silencing (
13). Alternatively, it might be responsible for degradation of RNA intermediates of the silencing pathway, such as siRNAs. Our unpublished observations indicate that transient expression of a WEL-1 transcription unit is sufficient to suppress RNA silencing in the model
N. benthamiana line 16c system. Experiments are currently under way to investigate a possible function of WEL-1 in
Arabidopsis in relation to siRNA- and miRNA-generating pathways.
In the Arabidopsis genome, WEL-1 is located within a cluster of seven genes (At3g12470 to At3g12410) coding for highly homologous proteins differing in size due to short deletions and short or long insertions or duplications. Their coding sequences are separated by about 700- to 1,000-bp-long noncoding regions of little similarity, one of which includes the WEL-1 promoter analyzed here. Another gene from this cluster (At3g12440) is also induced by either of the AC2 proteins, albeit rather weakly (2.4- and 2.7-fold), whereas At3g12470 and At3g12420 were not induced. The remaining three genes are not present on the ATH1 chip. It is tempting to speculate that members of the WEL cluster may have similar activities that are induced in response to individual factors.
Why would a host have evolved functions to suppress its own defense system? Besides protecting plant cells from viruses, RNA silencing may also regulate endogenous gene expression, as has been reported for the related miRNA pathway (
3,
7). Given the “infectious” nature of RNA silencing, which can amplify and spread systemically throughout the whole plant, a means to down-regulate and/or restrict this process would be desirable. Endogenous silencing suppressors could be involved in this negative regulation either by switching on certain silenced genes according to a developmental program and in response to environmental cues or by preventing the spread of silencing from a single cell or certain tissue where it has initiated. Endogenous silencing suppressors, like their viral counterparts, may act at different steps of RNA silencing and related mechanisms. In fact, viral suppressors might exploit an endogenous pathway by activating its individual components or a combination thereof to block silencing in concert.
Existence of the endogenous pathway of silencing suppression also has been suggested by identification of the calmodulin-related protein rgs-CaM in
N. benthamiana, which interacts with the viral suppressor HC-Pro in the yeast two-hybrid system and, like HC-Pro itself, suppresses GFP silencing in
N. benthamiana (
1). In this case, suppression by HC-Pro might be mediated by activation of rgs-CaM and subsequent amplification of an endogenous pathway that negatively regulates silencing (
1).
If, upon silencing suppression by AC2, reactions common to siRNA/miRNA production or action are affected, then some of the genes detected on the chips might have been elevated due to stabilization of their RNAs caused by reduced levels or inactivity of siRNA/miRNAs targeting them. The best candidates for this type of gene are two members of the Scarecrow-like family of plant-specific transcriptional factors, SCL6-II (At2g45160) and SCL8 (At5g52510), whose transcripts were elevated in the presence of AC2 (supplemental Table S3). SCL6-II has been predicted to be a target of miR-171, to which it has perfect complementarity, like its two isoforms, SCL6-III and SCL6-IV, identified as the targets for degradation by RNA-induced silencing complex-mediated cleavage (
29). Interestingly, the cleavage can be suppressed by the viral suppressor HC-Pro, leading to elevated levels of SCL6-III and SCL6-IV mRNAs (
24). However, we cannot conclude that AC2 is also capable of suppressing the miRNA pathway, because SCL6-III was only slightly elevated in the presence of AC2 and SCL6-IV, and several other predicted miRNA targets were not elevated at all. Yet some of the plant miRNAs might silence target genes by repressing translation of target mRNA without changing RNA accumulation, as documented for AP2-like transcription factors (
2). Furthermore, in our transient expression system, potential targets of miRNA/siRNA degradation pathways may become significantly elevated only at later time points (not analyzed here), after AC2-induced suppressor gene(s) have exerted their suppression effect.