A549, CHO, COS7, HepG2/C3A, Huh7.5, HaCaT, N29.1, SH-SY5Y, Vero and 293T cells (Table 1) were grown in Dulbecco’s modified eagle medium (DMEM) supplemented with 2 mmol/L L-Glutamine, non-essential amino acids, 100 U/mL penicillin and 100 μg/mL streptomycin in a humidified incubator at 37 °C with 5% CO₂. Passaging of the cells was carried out three times a week, reaching a maximum density of 90%.

The cells were infected with the ZIKV strain French Polynesia (PF13/251013-18) (this clinical low passage strain was kindly provided by Professor Musso, Institute Louis Marlade in Papeete, Tahiti).

The inoculum for the infection experiments was derived from Vero cells that were infected for 72 h with ZIKV Polynesia. The obtained cell culture supernatant was filtrated and characterized by titration using plaque assays. Defined aliquots were stored at -80 °C. The cell lines were infected with ZIKV at a MOI = 0.1 for 16 h. The inoculum was removed, cells were washed with prewarmed PBS, cultivated with medium for 32 h and harvested after 48 h if not stated differently.

At the present stage of knowledge no detailed information about the velocity of the infection process in the different cell culture systems is available. To avoid effects that reflect potential differences in the velocity of the infection process cells were infected for 16 h (overnight) to ensure a high infection level. The inoculum was removed, cells were washed with prewarmed PBS, cultivated with medium for 32 h and harvested after 48 h if not stated differently.

Vero cells were seeded at a density of 3 × 10⁵ cells per well in standard six well plates and infected with cleared, serial dilutions of either cell culture supernatant or cleared cellular lysate 6 h later. Another 2 h later, the inoculum was removed and the cells were washed twice with PBS. Then the cellular monolayers were overlaid with DMEM complete containing 0.4% seaplaque agarose. Four days later, the agarose overlay was removed and the wells were washed with PBS. Afterwards, the cells were fixed with 4% formaldehyde for 10 min and stained with 0.1% crystal violet for plaque visualization.

RNA from total lysate was isolated using peqGOLD TriFast (PEQLAB Biotechnologie GmbH, Germany) according to the manufacturer’s protocol. cDNA synthesis was performed after DNA digest with DNaseI (Promega, Mannheim, Germany), using 4 μg total RNA, RevertAid H Minus Reverse Transcriptase and random primer (Thermo Scientific, Dreieich, Germany) as suggested by the manufacturer.

RNA from cell culture supernatant was isolated using QIAamp viral RNA Mini Kit (Qiagen, Hilden Germany) as described by the manufacturer. However, the elution volume was decreased to 40 μL per sample.

Quantitative real-time PCR (qPCR) from total RNA was performed as described[17]. All relative quantifications were normalized to the amount of RPL27 transcripts. The following primers were used: Zika fwd (5’agatcccggctgaaacactg 3’-bp 1924-1943), Zika rev (5’ttgcaaggtccatctgtccc 3’-bp 1996-1977), ribosomal protein L27 - RPL27 fwd (5’ aaagctgtcatcgtgaagaac 3’) and RPL27 rev (5’ gctgctactttgcgggggtag 3’).

qPCR using RNA isolated from cell culture supernatant was analyzed using Zika LightMix Kit (TIB MOLBIOL, Berlin, Germany) in combination with LightCycler^® Multiplex RNA Virus Master (Roche, Mannheim Germany) as described by the companies protocols. In brief, 2.7 μL PCR grade water, 0.25 μL Zika Light Mix, 2 μL Roche Master, 0.05 μL RT Enzyme were mixed with 5 μL purified RNA and measured in the LightCycler 480 or Light cycler 1.2 (Roche, Mannheim Germany) with the following program: (1) RT-Step: 55 °C/5 min; (2) Denaturation: 95 °C/5 min; (3) Cycling (45 times): 95 °C/5 s, 60 °C/15 s, 72 °C/15 s; and (4) Cooling: 40 °C/30 s.

The samples were resolved by sodium dodecyl sulfate-polyacrylamid electrophoresis (SDS-PAGE) at 10% and transferred by semi-dry blotting onto a polyvinylidine difluoride membrane (PVDF) (0.45 μm; Carl Roth, Germany). The membrane was blocked with 5% skim milk solution and then incubated with anti NS1 specific antibody at a 1:1000 dilution (Biofront, United States) overnight. Then the membrane was incubated with a mouse specific secondary antibody coupled with horseradish peroxidase at a 1:2000 dilution (HRP) (GE Healthcare, United Kingdom) and signals were detected with X-ray films (GE Healthcare, United Kingdom). Signals were quantified using ImageJ software.

Immunofluorescence staining was analyzed with a confocal laser scanning microscope (CLSM 510 Meta; Carl Zeiss) and ZEN 2009 software. Cells were fixed with absolute ice-cold ethanol for 10 min. ZIKV envelope protein was stained using anti Flavivirus Group antigen Antibody (clone D1-4G2-4-15 from Merck-Millipore, Darmstadt Germany) and a polyclonal rabbit antiserum was used to detect STAT1 (Merck AB16951). As secondary antibodies served Alexa 488 and Alexa 546 (Thermo, Darmstadt Germany). Nuclei were stained with DAPI.

Cytolysis was monitored by LDH release assay (Clontech, Japan) and cell viability was assessed by Presto Blue staining (Thermo, Darmstadt Germany) according to the instructions of the manufacturer. Upon cellular damage lactate dehydrogenase (LDH) is released into the cell culture supernatant. This release is indirectly measured based on a calorimetric assay detecting an enzymatically formed formazan product. Presto Blue is a red compound that is taken up by the cells and due to the reducing interior environment turns into a red color that is detectable at 570 nm.

The used cell lines were transfected with the pISREluc construct (Agilent, United States), using polyethylenimine (PEI) directly after infection. In brief, 3 × 10⁵ cells per six well were infected as described and transfected directly after the addition of virus, using a transfection mix containing 1 μg plasmid DNA, 12 μL PEI (1 mg/mL) in a total volume of 150 μL PBS (1/10 total volume of media). The media was changed the next day and cells were analyzed 48 h post transfection. Here for cells were lysed in a passive lysis buffer (25 mmol/L Tris, 2 mmol/L DTT, 2 mmol/L EGTA, 10% glycerol (v/v), 1% TX-100 (v/v), pH 7.5) for 10 min on ice. Afterwards, lysate was cleared by centrifugation at 4 °C and 5000 × g for 10 min and the luciferase activity of the supernatant was measured in 96 well Orion II plate reader (Berthold, Germany) for 10 s after the addition of luciferase buffer (20 mmol/L Tris-HCl pH 7.8, 5 mmol/L MgCl₂, 0.1 mmol/L EDTA, 33.3 mmol/L DTT, 470 μmol/L Luciferin, 530 μmol/L ATP). Relative light units were normalized to the total protein amount by Bradford protein assay.

All statistical analyses were performed with Prism GraphPad 7.0, using multiple t tests for determination of P-values. Error bars are displayed as value ± SEM.

The capacity of various human- and non-human-derived cell lines to produce high amounts of infectious ZIKV particles was analyzed. For this purpose, ten different (human and non-human) cell lines (Table 1) derived from various tissues (neuronal cells, kidney cells, keratinocytes, hepatoma cells and lung epithelia cells) were tested with respect to their susceptibility to ZIKV infection. The investigated cells were infected with an identical MOI of 0.1, using ZIKV Polynesia strain. The intracellular amount of ZIKV-specific genomes was determined by RT-PCR 48 h after infection, revealing that for all analyzed cell lines with the exception of CHO cells a productive infection could be established. With respect to the number of intracellular genomes detected in the various cell lines (Figure 1A), only moderate differences between the permissive cell lines were found. However, the amount of viral genomes must not necessarily correlate with the amount of infectious viral particles. To address this point, the number of infectious particles in the cell lysates was determined. Quantification of the intracellular amount of infectious viral particles by plaque assay (Figure 1B) revealed strong differences between the investigated cell lines of up to 10⁵-fold. The highest amount of intracellular infectious viral particles was found for Vero cells containing 3.6 × 10⁷ PFU/mL followed by the Huh7.5, COS7, 293T and A549 cells. Again, N29.1 and SH-SY5Y cells showed significantly lower amounts of intracellular viral particles (8.7 × 10³ - 2.3 × 10³ PFU/mL). The HaCaT cells showed besides the CHO cells, which did not contain infectious viral particles, the lowest amount amongst the investigated cell lines (3 × 10² PFU/mL). Comparison between the quantification of the intracellular viral genomes and the infectious viral particles revealed that there is a correlation, but the differences between the various cell lines are much more pronounced with respect to the amount of infectious viral particles in comparison to the viral genomes.

Open in New Tab   Full Size Figure   Download Figure

Figure 1 ZIKV-infected cells differ significantly with respect to the intracellular amount of infectious viral particles. A: Cells were infected with an identical MOI of 0.1, using ZIKV Polynesia strain. Forty-eight hours after infection the intracellular amount of ZIKV-specific genomes was determined by RT-PCR. The data are the mean from four independent experiments. Amounts of Zika genomes are calculated using a Zika virus standard. A threshold value of 10 viral genomes was used. The bars represent the standard deviation of the mean. Statistical analysis was done by using 2-way ANOVA with Vero cells as reference value. ^aP < 0.05, ^bP < 0.01, ^dP < 0.0001; B: Cells were infected with an identical MOI of 0.1, using ZIKV Polynesia strain. Forty-eight hours after infection the cells were lysed and intracellular amount of infectious viral particles was determined by plaques assay using Vero cells. The data are the mean from four independent experiments. A threshold value of 10 plaques was used. The bars represent the standard deviation of the mean. Statistical analysis was done by using 2-way ANOVA with Vero cells as reference value. ^dP < 0.0001; C: Cells were infected with an identical MOI of 0.1, using ZIKV Polynesia strain. Forty-eight hours after infection the cells were lysed and intracellular amount of NS1 was determined by western blot analysis and referred to the amount of actin. The experiment was done in triplicate; one representative experiment is shown. Two different western blots from two independent experiments were quantified using Image J software. The relative NS1 amount represents the ratio between NS1 and actin; D: Cells were grown on cover slips and infected with an identical MOI of 0.1 using ZIKV Polynesia strain. Forty-eight hours after infection the cells were fixed by ethanol. To quantify the intracellular amount of ZIKV envelope protein and to analyze the subcellular distribution of the envelope protein in the different cell lines, confocal immunofluorescence microscopy was performed using an envelope-specific antibody (green fluorescence). Nuclei were stained by DAPI (blue fluorescence). The pictures were taken at 450-fold magnification; E: In two visual fields the total number of cells was determined by counting the number of DAPI-labeled cells. For quantification of ZIKV-positive cells immunofluorescence microscopy was performed using the envelope protein specific antibody 4G2. The percentage of ZIKV-positive cells was calculated and depicted in a diagram. ZIKV: Zika virus.

Quantification of intracellular viral genomes does not automatically reflect replication. To further analyze ZIKV replication, the intracellular amount of NS1 was determined by western blot analysis and referred to the amount of actin (Figure 1C). The quantification of the western blots demonstrates that between the different cell lines significant differences with respect to the intracellular amount of NS1 can be observed. Nearly the same pattern for the amount of NS1 can be observed as found for the intracellular genomes by RT-PCR. A549, COS7, HepG2/C3A, Huh7.5, Vero and 293T cells showed strongest signals, while lower amounts of NS1 were detected in N29.1 cells. No NS1 was measurable in SHY5Y and CHO cells. For the HaCaT cells in contrast to the qPCR data only a low amount of NS1 was observed.

To estimate the intracellular amount of ZIKV envelope protein and to analyze the amount of infected vs non-infected cells, confocal immunofluorescence microscopy was performed (Figure 1D). The staining showed that based on the plaque assays the highest producer cells also showed the best ratio between infected vs non-infected cells (Figure 1E). The confocal immunofluorescence microscopy shows for the A549, Vero and 293T cells a susceptibility between 72%-66%, while from the Huh7.5 and HaCaT cells approximately 52% and 42% and only around 10% of the HepG2/C3A, N29.1 and SH-SY5Y were infected after 48 h. In case of the CHO cells, no specific staining was observed confirming that these cells are not permissive for ZIKV.

To study the impact of ZIKV on cell viability and integrity in the different analyzed cell lines Presto Blue assays for determination of the cell viability and LDH assays for analysis of the cell integrity were performed. For this purpose the cells were infected for 48 h and stained for Presto Blue assays or the supernatant from ZIKV-infected cells was collected 48 h after infection and the LDH activity was determined (Figure 2). Both assays revealed that ZIKV heavily affects cell integrity/cell viability in A549 and Vero cells. Less cell death was observed for HepG2/C3A, HaCaT and N29.1 cells. Based on the data from these assays and microscopic analysis COS7, 293T and SH-SY5Y cells were found to be most resistant to ZIKV induced cytolysis.

Open in New Tab   Full Size Figure   Download Figure

Figure 2 In A549 and Vero cells Zika virus exerts a pronounced cytopathogenic effect. Cells were infected with ZIKV. A: Forty-eight hours post infection cell viability was analyzed by Presto blue assay; B: Cell integrity was analyzed by determination of the LDH-level in the cell culture supernatant. The data are the mean from three independent experiments. The bars represent the standard deviation of the mean.

To investigate whether the data obtained for the analysis of the intracellular amount of viral genomes and infectious viral particles are reflected by the numbers of genomes and infectious viral particles in the supernatant, media from the infected cell cultures were analyzed 48 h after infection. The RT-PCR (Figure 3A) revealed that in accordance to the results obtained for the quantification of the intracellular genomes, CHO released no viral genomes. As observed for the intracellular amount of viral genomes, there were no major differences in the amount of released viral genomes between the different cell lines. The difference between the highest amount observed for A549, HaCaT and Vero cells on the one side and N29.1 or SH-SY5Y cells on the other side is less than 2 fold. As the amount of viral genomes in the supernatant must not correlate with the amount of infectious viral particles, the number of infectious viral particles in the cell culture supernatants was determined by virus titration assays (Figure 3B). In contrast to the moderate differences that were found analyzing the number of viral genomes, strong differences (more than 10²-fold) were revealed with respect to the number of infectious viral particles released by the different cell lines. The highest amounts were detected for supernatants derived from Vero-, A549-, COS7-, HepG2/C3A-, Huh7.5-, HaCaT- and 293T-cells that produced nearly the same quantity of infectious viral particles (about 10⁷/mL). The neuronal cell lines N29.1 and SH-SY5Y cells released more than 100 times less infectious viral particles than Vero cells. For CHO cells no significant amount of released viral particles was detectable.

Open in New Tab   Full Size Figure   Download Figure

Figure 3 Zika virus-infected cells release comparable amounts of viral genomes but differ significantly with respect to the intracellular amount of infectious viral particles. A: The indicated cell lines were infected with a MOI = 0.1, RNA was isolated from the supernatant 48 h post infection and analyzed by qPCR. Amounts of Zika genomes are calculated using a Zika virus standard. Shown are the amounts of genomes/mL in the supernatant from four independent experiments. A threshold value of 10 viral genomes was used. The bars represent the standard errors of the mean. Statistical analysis was done by using 2-way ANOVA with Vero cells as reference value. ^bP < 0.01, ^dP < 0.0001; B: The indicated cells were infected with a MOI = 0.1 and supernatant was harvested 48 h post infection. To quantify the amount of released infectious viral particles, the obtained supernatants were used for plaque assays on Vero cells. Plaques were visualized and counted 4 d after infection. The data are from four independent experiments. A threshold value of 10 plaques was used. The bars represent the standard errors of the mean. Statistical analysis was done by using 2-way ANOVA with Vero cells as reference value. ^aP < 0.05.

Induction of interferon-stimulated genes (ISGs) was analyzed by luciferase reporter assay using the Interferon-stimulated response element (ISRE) as promoter-driving luciferase expression. Cells were infected as described, transfected with pISREluc plasmid and the cellular luciferase activity was analyzed 48 h post infection (Figure 4A). Luciferase assay showed an induction of ISGs only for the N29.1 cells. In the rest of the tested cells ISGs were slightly repressed. However, staining of STAT1 suggests a delocalization by ZIKV (Figure 4B). If ZIKV was present in the cells it occurred like STAT1 is drawn to the replication factories and no longer is evenly distributed as seen in uninfected cells.

Open in New Tab   Full Size Figure   Download Figure

Figure 4 Delocalization of STAT1 in Zika virus-infected cells. A: The indicated cell lines were either infected with a MOI = 0.1 or left uninfected and directly afterwards transfection with the pISREluc reporter was performed. 16 h later the cells were washed once with PBS and luciferase activity was measured 48 hpi. The data are from three independent experiments and for each cell line the uninfected controls were set as one, acting as the reference. The bars represent the standard errors of the mean. Statistical analysis was done by using 2-way ANOVA with Vero cells as reference value. ^bP < 0.01, ^dP < 0.0001; B: Detection of STAT1 by confocal immunofluorescence microscopy of ZIKV-infected and uninfected A549 cells. Cells were grown on cover slips and infected with a MOI of 0.1 using ZIKV Polynesia strain. 6 h after infection the cells were fixed with ethanol. Detection of STAT1 was performed using the green channel and Zika specific staining was performed using an envelope-specific antibody (green fluorescence). Nuclei were stained by DAPI (blue fluorescence). The pictures were taken at 450-fold and 1000-fold magnification respectively (scale bars represent 10 μm). ZIKV: Zika virus.

Taken together, these data indicate that the analyzed cell lines strongly differ with respect to the amount of released viral particles, although comparable amounts of viral genomes are detectable in the supernatant. With respect to the identification of cell culture systems that are suitable to produce high amounts of infectious viral particles, Vero- and COS7 cells as a non-human-derived cell lines and Huh7.5-, A549 and 293T cells as human-derived cell culture systems were identified.

Zika virus (ZIKV) is an emerging virus transmitted mainly by mosquitos, that has spread during the last decades from Africa, to Asia, over Micronesia to the Americans causing an epidemic in Brazil in the years 2016/2017. In order to propagate the virus in cell culture we investigated various cell lines for their susceptibility to ZIKV infection.

To date ZIKV is mainly propagated in Vero cells derived from kidney epithelial cells from African green monkey. This study aimed to investigate the potential of various cell lines to support the viral life cycle in order to provide researchers with suitable cell culture systems for different issues in the field of ZIKV research.

The objectives of this research were to investigate ten human and non-human cell lines from various tissues (e.g., hepatocytes, keratinocytes and neuronal cells) with regard to their intracellular amount of viral genomes and infectious viral particles upon ZIKV-infection. Moreover, the amount of secreted viral genomes and infectious viral particles was analyzed in the cell culture supernatants. Furthermore, the amount of infected cells was analyzed by immunofluorescence using an Envelope-specific antibody and the amount of NS1 was analyzed by western blot. In order to draw a conclusion whether parts of the innate immune response are responsible for the found differences in viral support, STAT1 distribution and expression was analyzed.

Quantification of viral genomes was performed by qPCR. For the detection of genomes from whole cell lysate a standard PCR protocol with SYBR green was used with cDNA as template transcribed from total RNA that was isolated with a Tri-reagent. Viral genomes released into the cell culture supernatant were isolated with a viral RNA isolation kit and subjected to a Taqman-PCR based on a ZIKV-Lightmix Kit. The detection of infectious virus was performed by virus titration assay using serial dilutions from the supernatant or from cleared cellular lysates. The amount of infected cells was analyzed with immunofluorescence microscopy by using an Env-specific antibody and with western blot using NS1-specific antibody. The effect on the innate immunity was monitored by luciferase-reporter assay and STAT1 distribution was analyzed by immunofluorescence microscopy.

All investigated cell lines except CHO cells supported infection, replication and release of ZIKV. While in infected A549 and Vero cells a pronounced cytopathic effect was observed COS7, 293T and Huh7.5 cells were most resistant. Although the analyzed cell lines released comparable amounts of viral genomes to the supernatant significant differences were found for the number of infectious viral particles. The neuronal cell lines N29.1 and SH-SY5Y released 100 times less infectious viral particles than Vero-, A549- or 293T-cells. However there is no strict correlation between the amount of produced viral particles and the induction of an interferon response in the analyzed cell lines.

The results presented so far provide a toolbox of cell culture systems for ZIKV research in general. However, the analyzed cells differ strongly with respect to the amount of released viral particles, whereas the amount of genomes amongst the cells in the supernatant and inside of infected cells are more or less equal. This is an important finding, since a lot of research and diagnostic is based on qPCR analysis only.

Further research should aim on the differences of released viral genomes vs released infectious virus. Are there differences in the release pathway? Which pathways are used for viral egress? Why are certain cell lines not succeptible?