African Origin of Modern Humans in East Asia: A Tale of 12,000 Y Chromosomes
Abstract
To test the hypotheses of modern human origin in East Asia, we sampled 12,127 male individuals from 163 populations and typed for three Y chromosome biallelic markers (YAP, M89, and M130). All the individuals carried a mutation at one of the three sites. These three mutations (YAP+, M89T, and M130T) coalesce to another mutation (M168T), which originated in Africa about 35,000 to 89,000 years ago. Therefore, the data do not support even a minimal in situ hominid contribution in the origin of anatomically modern humans in East Asia.
Get full access to this article
View all available purchase options and get full access to this article.
REFERENCES AND NOTES
1
Cann R. L., Stoneking M., Wilson A. C., Nature 325, 31 (1987).
2
Vigilant L., Stoneking M., Harpending H., Hawkes K., Wilson A. C., Science 253, 1503 (1991).
3
Stringer C. B., Andrew P., Science 239, 1263 (1988).
4
Bowcock A. M., et al., Nature 368, 455 (1994).
5
Hammer M. F., Nature 378, 376 (1995).
6
Tishkoff S. A., et al., Science 271, 1380 (1996).
7
Chu J. Y., et al., Proc. Natl. Acad. Sci. U.S.A. 95, 11763 (1998).
8
Quintana-Murci L., et al., Nature Genet. 23, 437 (1999).
9
Su B., et al., Am. J. Hum. Genet. 65, 1718 (1999).
10
Krings M., et al., Cell 90, 19 (1997).
11
Igor V. O., et al., Nature 404, 490 (2000).
12
Brooks A. S., Wood B., Nature 344, 288 (1990).
13
Li T., Etler D. A., Nature 357, 404 (1992).
14
X. Z. Wu, F. E. Poirier, Human Evolution in China (Oxford Univ. Press, Oxford, 1995).
15
Etler D. A., Annu. Rev. Anthropol. 25, 275 (1996).
16
Swisher C. C., et al., Science 274, 1870 (1996).
17
A total of 163 populations were sampled from Central Asia (Crimean Tatar, Iranian, Dungan, Tajik, Turkmen, Karakalpak, Eastern Uzbek, Sinte Romani, Khorezmian Uzbek, Uighur, Kazak, Bukharan Arab, and Kyrgyz); Central Siberia (Tuvan, Tofalar, Yenisey Evenk, Buryat-1, and Buryat-2); Okhotsk/Amur (Okhotsk Evenk, Ulchi/Nanai, Upriver Negidal, Downriver Negidal, Udegey, and Nivkh); Kamchatka/Chukotka (Koryak, Itelman, Chukchi, and Siberian Eskimo); northern East Asia (Ewenki, Manchurian-1, Manchurian-2, Korean, Japanese, Hui-1, Hui-2, Jingpo, Tu, Sala, Mongolian-1, Mongolian-2, Tibetan-Qinghai, Tibetan-Tibet, Tibetan-Yunnan, Kazak-Xinjiang, and Uyghur); northern Han Chinese (Heilongjiang, Liaoning, Hebei, Beijing, Tianjin, Shandong, Shanxi, Gansu, Xinjiang, Henan, Inner-Mongolia, Qinghai, Shaanxi, and Jilin); southern Han Chinese (Anhui, Zhejiang, Jiangsu, Shanghai, Hubei, Sichuan, Jiangxi, Hunan, Fujian, Yunnan, Guangxi, Guangdong, and Guizhou); Taiwan (Bunun, Atayal, Yami, Paiwan, and Ami); Southeast Asia (Tujia, Yao-Nandan, Yao-Jinxiu, Zhuang, Dong, Wa-1, Wa-2, Wa-3, Aini, Blang-1, Blang-2, Lahu-1, Lahu-2, Lahu-3, Lahu-4, Deang, Yi, She, Li, Cambodian, Dai-1, Dai-2, Akha, Karen, Lisu, Jino, Hmong, Yao, Kinh, Muong, Naxi, Ahom, So, Northern Thailand, Northeast Thailand, Bai-1, and Bai-2); Indonesia/Malaysia [Malay CB, Malay KM, Orang Asli, Batak, Malay (Pakanbaru), Minangkabau, Palembang, Bangka, Nias, Dayak, Java, Tengger, Bali, Sasak, Sumbawa, Sumba, Alor, Makassar, Bugis, Torajan, Kaili, Manado, Irian, Kota Kinabalu, and Sakai]; Polynesia/Micronesia (Truk, Guam, Palau, Majuro, Kribati, Pohnpei, Nauru, Kapingamarangi, Tonga, American Somoan, and West Somoan); Papuan and New Guinean Highland (Australian Aborigine, Nasioi-Melanesian, New Guinean-1, New Guinean-2, Bankes and Torres, Santo, and Maewo); and Northeastern India [Adi, Nishi, Assam, Apatani, Rabha(Assam), and Naga]. The numbered populations of the same ethnicity were sampled independently.
18
Genotyping was conducted by a polymerase chain reaction restriction fragment length polymorphism assay. The restriction sites were engineered for M130 (Bsl I) and M89 (Nla III) by designing mismatch primers. The primer sequences are ACAGAAGGATGCTGCTCAGCTT/GCAACTCAGGCAAAGTGAGACAT (M89) and TATCTCCTCTTCTATTGCAG/CCACAAGGGGGAAAAAACAC (M130). The typing of YAP follows previous reports (5, 9). Genotyping was repeated to clarify any equivocal typing results.
19
Jobling M. A., et al., Trends Genet. 11, 449 (1995).
20
Underhill P. A., et al., Ann. Hum. Genet. 65, 43 (2001).
21
Underhill P. A., et al., Nature Genet. 26, 358 (2000).
22
Bergen A. W., et al., Ann. Hum. Genet. 63, 63 (1999).
23
Wolpoff M. H., Hawks J., Caspari R., Am. J. Phys. Anthropol. 112, 129 (2000).
24
Jin L., Su B., Nature Rev. Genet. 1, 126 (2000).
25
Stoneking M., et al., Curr. Opin. Genet. Dev. 6, 731 (1996).
26
Harding R. M., et al., Am. J. Hum. Genet. 60, 772 (1997).
27
Kaessmann H., Heissig F., Haeseler A., Paabo S., Nature Genet. 22, 78 (1999).
28
Harris E., Hey J., Proc. Natl. Acad. Sci. U.S.A. 96, 3320 (1999).
29
Zhao Z. M., et al., Proc. Natl. Acad. Sci. U.S.A. 97, 11354 (2000).
30
Fay J. C., Wu C. I., Mol. Biol. Evol. 16, 1003 (1999).
31
We thank all the 12,127 men who donated DNA for this study. This study was supported by the China Natural Science Foundation. B.S., R.C., and L.J. were supported by NIH grants. R.D. was supported by the Center for Environmental Genetics at the University of Cincinnati.
(0)eLetters
eLetters is a forum for ongoing peer review. eLetters are not edited, proofread, or indexed, but they are screened. eLetters should provide substantive and scholarly commentary on the article. Embedded figures cannot be submitted, and we discourage the use of figures within eLetters in general. If a figure is essential, please include a link to the figure within the text of the eLetter. Please read our Terms of Service before submitting an eLetter.
Log In to Submit a ResponseNo eLetters have been published for this article yet.
Information & Authors
Information
Published In
Science
Volume 292 | Issue 5519
11 May 2001
11 May 2001
Submission history
Received: 20 February 2001
Accepted: 20 March 2001
Published in print: 11 May 2001
Authors
Metrics & Citations
Metrics
Article Usage
Altmetrics
Citations
Cite as
- Yuehai Ke et al.
Export citation
Select the format you want to export the citation of this publication.
Cited by
- Forensic Analysis and Genetic Structure Construction of Chinese Chongming Island Han Based on Y Chromosome STRs and SNPs, Genes, 13, 8, (1363), (2022).https://doi.org/10.3390/genes13081363
- Fine-Scale Population Admixture Landscape of Tai–Kadai-Speaking Maonan in Southwest China Inferred From Genome-Wide SNP Data, Frontiers in Genetics, 13, (2022).https://doi.org/10.3389/fgene.2022.815285
- The Chinese Expansion and Language Coexistence in Modern China, The Cambridge Handbook of Language Contact, (64-83), (2022).https://doi.org/10.1017/9781316796146.006
- Language Contact and Genetic Linguistics, The Cambridge Handbook of Language Contact, (41-186), (2022).https://doi.org/10.1017/9781316796146.004
- , Moderní chemická analýza v archeologii, I. díl, (2021).https://doi.org/10.5507/prf.21.24459486
- Tracing Modern Human Origins, Science, 309, 5743, (1995-1997), (2021)./doi/10.1126/science.309.5743.1995b
- MTHFR rs1801133 polymorphism in Bangladeshi population – its prevalence and detection, Asia Pacific Journal of Molecular Biology and Biotechnology, (94-101), (2020).https://doi.org/10.35118/apjmbb.2020.028.4.08
- A new phylogenetic protocol: dealing with model misspecification and confirmation bias in molecular phylogenetics, NAR Genomics and Bioinformatics, 2, 2, (2020).https://doi.org/10.1093/nargab/lqaa041
- Role of culture in the emotional response towards komodo dragon in Komodo and Rinca Islands of Komodo National Park, BIO Web of Conferences, 19, (00021), (2020).https://doi.org/10.1051/bioconf/20201900021
- Human Attitude toward Reptiles: A Relationship between Fear, Disgust, and Aesthetic Preferences, Animals, 9, 5, (238), (2019).https://doi.org/10.3390/ani9050238
- See more
Loading...
View Options
Check Access
Log in to view the full text
AAAS login provides access to Science for AAAS Members, and access to other journals in the Science family to users who have purchased individual subscriptions.
- Become a AAAS Member
- Activate your AAAS ID
- Purchase Access to Other Journals in the Science Family
- Account Help
Log in via OpenAthens.
Log in via Shibboleth.
More options
Register for free to read this article
As a service to the community, this article is available for free. Login or register for free to read this article.
Buy a single issue of Science for just $15 USD.