Recovery of infectious murine norovirus using pol II-driven expression of full-length cDNA
Edited by Mary K. Estes, Baylor College of Medicine, Houston, TX, and accepted by the Editorial Board May 16, 2007
Abstract
Noroviruses are the major cause of nonbacterial gastroenteritis in humans. These viruses have remained refractory to detailed molecular studies because of the lack of a reverse genetics system coupled to a permissive cell line for targeted genetic manipulation. There is no permissive cell line in which to grow infectious human noroviruses nor an authentic animal model that supports their replication. In contrast, murine norovirus (MNV) offers a tractable system for the study of noroviruses with the recent discovery of permissive cells and a mouse model. The lack of a reverse genetic system for MNV has been a significant block to understanding the biology of noroviruses. We report recovery of infectious MNV after baculovirus delivery of viral cDNA to human hepatoma cells under the control of an inducible DNA polymerase (pol) II promoter. Recovered virus replicated in murine macrophage (RAW264.7) cells, and the recovery of MNV from DNA was confirmed through recovery of virus containing a marker mutation. This pol II promoter driven expression of viral cDNA also generated infectious virus after transfection of HEK293T cells, thus providing both transduction and transfection systems for norovirus reverse genetics. We used norovirus reverse genetics to demonstrate by mutagenesis of the protease–polymerase (pro–pol) cleavage site that processing of pro–pol is essential for the recovery of infectious MNV. This represents the first infectious reverse genetics system for a norovirus, and should provide approaches to address fundamental questions in norovirus molecular biology and replication.
Sign up for PNAS alerts.
Get alerts for new articles, or get an alert when an article is cited.
Noroviruses (Caliciviridae) are the most common cause of nonbacterial acute gastroenteritis with an estimated 23 million cases and 50,000 hospitalizations per year in the USA alone (1). They are a global problem causing significant morbidity and are of particular concern in semiclosed environments, such as the military, hospitals, schools, hotels, and cruise ships (2–5). Significant efforts are being made to prevent, or develop treatments for, this major food-borne disease. To date, no antiviral drugs or vaccines are available.
Human noroviruses are noncultivable, and despite infectious clone systems being developed for other Caliciviridae genera (6–9), a reverse genetics system for noroviruses has remained unsolved, apart from Norwalk virus (10), for which the lack of permissive cell lines or a small animal model limits options for direct study (11). An alternative is the recently described murine norovirus (MNV) (12). This virus has been proposed as a model norovirus system, because it can be replicated in mice, grown in cultured primary dendritic cells, macrophages, and continuous macrophage cells, and a range of susceptible mouse strains are available for pathogenicity studies (13).
MNV was first identified in RAG2/STAT1−/− mice (12), with histopathological investigation of MNV infected STAT1−/− mice showing virus replication in cells resembling macrophages or dendritic cells (14). Subsequently, MNV has been identified around the world, with up to 22% of serum from research colonies in the United States and Canada proving positive for this virus, often presenting as a subclinical infection in mice with a functioning innate immune response (15) (data not shown). The MNV genome consists of 7.4 kb of positive-sense single-stranded RNA with a 3′ polyA tail. The genome encodes three ORFs comprising a 187.5-kDa replicase polyprotein, the 60-kDa capsid ORF, and a low-abundance 22-kDa basic protein. The autocatalytic replicase polyprotein is expressed from genomic RNA and includes a protein of unknown function called N-term and the better defined NTPase, 3A-like, VPg, 3C-like, and RNA-dependent RNA polymerase proteins (16). The capsid protein, VP1, is expressed from a sub genomic RNA fragment. Overall, the genome and expressed proteins of MNV correspond well to the genome and expressed proteins of human noroviruses (17–21).
This article reports the development of the first reverse genetics system for MNV that generates infectious virus from a genomic cDNA clone. Two approaches generated infectious MNV; transduction-based delivery of cDNA under control of a pol II promoter into human hepatocellular carcinoma cell line G2 (HepG2) cells, or transfection of the pol II promoter construct into HEK293T cells. Recovered MNV replicated in susceptible RAW 264.7 cells. We show that the MNV genome can be manipulated and that a genetically modified infectious virus can be recovered. This study describes an important advance for the field of noroviruses, because it will now be possible to perform a full genetic analysis of norovirus gene function. We demonstrate this principle through mutagenesis of the pro–pol cleavage site to show that pro–pol cleavage is essential for recovery of infectious virus. The availability of both transduction and transfection reverse genetic systems will allow reverse genetic experiments in a range of cell types and may provide methods relevant to other noroviruses.
Results
Recombinant MNV Expression and Recovery.
A two-component baculovirus expression system used to produce recombinant MNV is shown schematically in supporting information (SI) Fig. 4. This system allows the use of a regulated pol II promoter by separate delivery of the encoded MNV genome and a transactivator. The baculovirus clone BACTETtTA expressing the tetracycline repressor/VP16 transactivator from a CAG mammalian promoter has been described (22). Recombinant MNV baculovirus BACTETMNV was propagated in Sf9 cells and concentrated to a titer of 109 pfu/ml. Transduction of 106 HepG2 cells with 108 pfu of BACTETtTA or BACTETMNV alone caused no cytopathic effect (CPE) in the HepG2 cells (Fig. 1 A and B). However, simultaneous cotransduction with both baculoviruses led to rapid CPE within 24 h (Fig. 1C), indicative of the expression of MNV proteins within transduced cells.
Fig. 1.
Passage of the double-transduced HepG2 cell lysates in RAW264.7 cells resulted in the development of typical MNV CPE (Fig. 1 E–H), however, no CPE was observed when either the transactivator or MNV baculovirus transduced HepG2 cell material were passaged individually onto RAW264.7 cells (data not shown). CPE in HepG2 cells was a reliable indicator of MNV production. We recovered infectious MNV with two separate batches of each recombinant baculovirus and six separate cotransduction reactions. The recovery of infectious MNV was independently observed in two separate laboratories (Southampton and St. Louis).
The recovered virus could be plaqued on RAW264.7 cells (Fig. 1 D) and HepG2 yields of ≈2 × 102 pfu/ml were obtained. The recovered MNV could be passaged in RAW264.7 cells, reaching titers of 5 × 107 per ml. Passage of HepG2 lysates upon HepG2 cells did not lead to CPE, confirming the requirement of the permissive RAW264.7 cell line for virus propagation. Direct transduction of RAW264.7 cells did not yield a recoverable virus; however, RAW264.7 cells are not transduced efficiently by baculovirus (23).
Transfection of HepG2, BHK-21, COS-7, or HEK293T cells with the pFBTETtTA and pFBTETMNV plasmids produced recoverable virus. Virus was not recovered from RAW cells transfected in a similar manner. Of note, transfection of the pFBTETMNV plasmid or the MNV genome in plasmid pSP73 under the control of the minimal CMV promoter produced recoverable virus in the absence of the transactivator in HEK293T cells. There was no observable CPE in HEK293T cells; however, immunofluorescence with monoclonal antibodies to the VPg and N-term proteins indicated a high number of cells expressing the N-term protein (Fig. 1 Q–T). The recovery of virus was confirmed by direct plaque assay of the recovered HEK293T cell lysates on RAW264.7 cells with a yield of 5 × 103 pfu/ml.
Serological Identification of MNV.
Confirmation of MNV recovery was undertaken by immunofluorescence in RAW264.7 cells with monoclonal antibodies specific to structural and nonstructural proteins. The majority of the cells expressed VPg, N-term (nonstructural) proteins, and viral capsid protein (Fig. 1 I–O). Western blot analysis with polyclonal serum to the MNV capsid detected a protein at ≈60 kDa (Fig. 2A), confirming the production of MNV capsid protein.
Fig. 2.
Characterization of Recovered MNV Genome.
All 7 kb of the recMNV genome derived from baculovirus transduction, apart from the very 5′ and 3′ termini, was recovered by RT-PCR with 15 primer pairs (SI Fig. 5). Reverse transcriptase negative controls confirmed that the products were derived from MNV RNA. No product was generated when the reverse transcriptase negative control reactions were repeated on infected RAW264.7 total cellular RNA that had not been subjected to DNase treatment, confirming and that no baculovirus genomic material was present (data not shown). The RNA used in the RT-PCRs was from MNV that had been passaged 5 times, confirming the stability of the recombinant construct. RACE analysis of the 5′ and 3′ ends of MNV returned the correct genomic sequence termini from multiple RACE clones (SI Fig. 6) and confirmed the presence of a polyA tail at the 3′ end of the recombinant genome. The complete consensus genome sequence of recMNV from direct sequencing of RT-PCR products was identical to the sequence of MNV strain CW1P3 (DQ285629), from which the full-length clone was derived (14).
Modification and Recovery of a Marked MNV.
A specifically marked virus was constructed to confirm that the recovered MNV was derived from the genomic cDNA clone and was not the result of inadvertent contamination of cells with infectious MNV. Analysis of 17 complete or partial MNV sequences derived from screening studies (C.E.W., L.B.T., and H.W.V., unpublished data) identified a conserved region adjacent to base 1000 (Fig. 2B) that fell between unique enzyme sites in the pFBTETMNV plasmid. Nucleotide 1001 was selected because it was highly conserved yet displayed a change in one isolate, indicating that this position could tolerate change within a quasi-species context, but that wide scale variation in the natural population was unlikely at this point. The incorporated change has not been identified in any reported MNV sequence and is not in any of the strains held in our laboratories. The mutation of this base to an A created a silent coding mutation and a unique EcoRV restriction site for rapid screening. The modified EcoRV containing virus (MNV*) was recovered as described for recMNV and the presence of the EcoRV site confirmed by the release of the 674- and 167-bp fragments from the 841-bp RT-PCR product following digestion (Fig. 2C). Complete digestion of the RT-PCR product indicates that this is a stable change tolerated within the quasi-species through multiple passages. This site was not present in the recMNV RT-PCR product. Reverse transcriptase negative and uninfected cellular RNA were negative for amplification. These data confirm isolation of infectious MNV from cDNA.
Mutation of pro–pol Cleavage Site.
The single-plasmid system was also shown to be suitable for MNV engineering through the modification of the pro–pol cleavage site. Transfection of HEK293T cells led to the production of orf1 proteins as evidenced by probing with the N-term and VPg monoclonal antibodies (Fig. 1 U–X). This showed the presence of N-term and VPg in transfected cells, and hence that orf1 expression was occurring and the pro–pol fusion retained protease activity. This was confirmed by Western blot analysis of transfected HEK293T cells with monoclonal antibody to N-term (Fig. 3). Both MNV* and the pro–pol cleavage mutant in pSP73 showed production, and hence cleavage, of N-term from the orf1 polyprotein. It was also evident that the pSP vector was more efficient than pFB vectors (Fig. 3). However, no infectious virus could be recovered from cells transfected with the pro–pol cleavage mutant, indicating that in contrast to feline calicivirus (24), pro–pol cleavage is essential for the recovery of infectious virus.
Fig. 3.
Discussion
Despite the existence of a feline calicivirus reverse genetics system for over 10 years and systems available for other genera of caliciviruses (6–9), the noroviruses have remained recalcitrant to reverse genetics despite intensive efforts to develop such systems by many laboratories over a number of years. The only previous success has been the generation of Norwalk virus particles in a T7-based system (10). Despite this advance, NV does not have a permissive cell line or small animal model in which to study the biology and pathology of this genus in conjunction with application of a reverse genetics system. This report provides the essential missing link in the range of tools necessary to dissect the molecular and cellular biology of MNV and thus shed light on noroviruses, major contributors to human disease worldwide. This is complemented by the availability of mouse strains with variable susceptibility to MNV, known strains of MNV with a range of pathogenic phenotypes, permissive cell lines and perhaps most importantly, the wide range of immunological tools available using mice.
Other calicivirus reverse genetic systems have focused on the use of cytoplasmic T7 promoters in various forms and the cytoplasmic capping function of poxviruses to recover virus (8). The use of poxviruses can cause CPE in host cells and can affect viral recovery. We reasoned that efficient delivery of cDNA coupled with the use of a pol II promoter would allow nuclear processing and export of capped viral transcripts to the cell cytoplasm. This viral transcript would both facilitate expression of viral nonstructural proteins and act as a template for generation of the negative sense genome, leading to the subsequent production of VPg-linked viral RNA.
The HepG2 cell line was selected because, unlike RAW264.7 cells, it is highly susceptible to baculovirus transduction (25). Further, Asanaka et al. (10) showed that NV particles could be recovered in a nonpermissive cell line. Although we were unable to recover MNV from transduced RAW264.7 cells, recovery of MNV from HepG2 cell lysates in RAW264.7 cells was entirely repeatable. Although coculture of HepG2 and RAW264.7 cells was not undertaken, it is reasonable to assume that such a system could further streamline recMNV production. The growth of recMNV in RAW264.7 cells reached comparable titers to those reported for wild type virus.
Although transduction of HepG2 cells was successful, a single-plasmid system would be more facile under many circumstances. In addition, it is likely that other noroviruses may require alternate delivery systems or cells. To address this, we investigated the use of the HEK293T cell line, which is highly susceptible to transfection. This was also successful and reinforced the use of a pol II promoter for the production of this norovirus genome. It is interesting to note that unlike baculovirus transduction of HepG2 cells, no transactivator is required in HEK293T cells, and no CPE is observed in these cells.
The use of the two-component baculovirus system was an essential aspect of our experimental design, providing internal controls that allowed the individual nonexpressing constructs to be tested separately. Using mammalian promoters in a baculovirus system minimizes potential toxicity effects during baculovirus production, and the separation of transactivator from the expression construct essentially eliminated any background expression from these promoters in an insect cell. The tTA expressing baculovirus is a constant in the system, meaning that all of the viral genomic information is on a single pFastbac plasmid, simplifying future manipulation of the genome.
Comparison of the two systems suggests that the critical common aspect allowing recovery of MNV was the use of a pol II promoter for generation of a capped transcript. If this technology can be transferred to human noroviruses, then the option of two delivery systems may increase the range of cells to which constructs can be delivered efficiently.
Sequence analysis of the recMNV showed that the correct 5′ terminus was generated and that the presence of the AgeI site used to place precisely the 5′ terminus of the MNV genome did not preclude correct transcription initiation. The recovery of the correct 5′ end is important for authenticity of the recovered virus as future manipulations of the genome will not be biased by 5′ terminal variations causing unknown effects. The virus is clearly able to resolve any capping or processing problems associated with the primary transcript. The recovery of a stable marked virus confirms that MNV is regenerated through reverse genetics and, most importantly, confirms that the MNV genome can be manipulated and that viable virus can be recovered.
Proof of principle that reverse genetics can supply new information on noroviruses was shown through elimination of the pro–pol consensus cleavage sequence. This mutation in feline calicivirus (Vesivirus genus) failed to eliminate viral replication and recovery (24), indicating that processing of pro–pol is not essential for viral recovery in this calicivirus genus. Our data show that the pro–pol fusion retains protease activity but that no virus can be recovered from this mutant viral genome. This is similar to poliovirus where the pro–pol fusion (3CD) retains protease processing of structural and nonstructural proteins, but no polymerase activity is detectable in the absence of processing to release 3D (polymerase) (26). These data highlight the potential for differences between vesiviruses and noroviruses and the need for detailed studies of norovirus replication.
In summary, we have developed a robust system that exploits pol II expression of a norovirus genome. The pol II promoter is regulatable through the baculovirus delivery system. The system exploits the baculovirus transduction of mammalian cells coupled with facile production in a two-component expression system where regulated control is desired. In addition a rapid and simple single-plasmid transfection through HEK293T cells allows for the efficient and facile recovery of recombinant MNV. Virus recovery is highly repeatable, the systems can be transferred successfully to other laboratories, and an authentic genome is recovered. This system should allow substantial insights into the pathology and biology of the Norovirus genus of the Caliciviridae.
Materials and Methods
Cells and Media.
Spodoptera frugiperda (Sf9) cells (Invitrogen, Carlsbad, CA) were grown as adherent or suspension cultures in TC100 medium supplemented with 10% FBS (Invitrogen). Human hepatocellular liver carcinoma cells (HepG2) were grown on collagen (Sigma–Aldrich, St. Louis, MO) coated culture ware in DMEM supplemented with 10% FBS, nonessential amino acids, 25 mM Hepes, and glutamax-1 (Invitrogen). RAW 264.7 and HEK293T cells were grown in DMEM supplemented with 10% FBS, 25 mM Hepes, and glutamax-1 (Invitrogen). For immunofluorescence, cells were grown on polylysine-coated cover slips as per manufacturers instructions (Sigma–Aldrich). BHK-21 and COS-7 cells were grown in DMEM supplemented with 10% FBS.
Antisera.
TET-Activated Expression System.
The expression system used was a two baculovirus system involving transduction of mammalian cells with one baculovirus expressing a TET-R/VP16 transactivator from a pol II CAG promoter to activate a TET-O/minCMV promoter on a second baculovirus carrying a full length clone of the MNV genome as described in ref. 22. The parental vector used in this study was designated pFBTET and was constructed from the FastBac vector pFBrep5.1neo(Δ3′U) (28) containing the TET-O/minCMV promoter, which had been modified to include an AgeI restriction site immediately before the identified transcription initiation point of the minimal CMV promoter (25).
MNV Genome Cloning.
A full length clone of MNV-1 strain CW1P3 in the plasmid pSport-1 was used as the template (16). The 5′ end of the MNV genome was amplified by PCR, using Accuzyme polymerase (Bioline, Randolph, MA) with primer AgeI-21 (5′ AACTTGGGATCCACCGGTGTGAAATGAGGATGGC-AACGC) containing an AgeI site (underlined) followed immediately by the first 21 bases of the MNV genome (italics) and primer MNV1085–1056 (5′CATCCCGATCCCGCCCAACAGG), which binds 3′ of a unique ApaI site at nucleotide position 1034 in the MNV genome cDNA. The resulting PCR product was cloned into pCRBlunt (Invitrogen), sequenced on an ABI 377 sequencer, and isolated as an AgeI-ApaI fragment by gel extraction (Sigma–Aldrich; GenElute kit).
The 3′ end of the genome was modified to contain a polyA tail, hepatitis delta virus (HδV) ribozyme and a NotI restriction site. Primer BspF (5′ CCTCCTAAGCTTCCGGA-CCTACATGCGTCAGA), spanning a unique BspEI site in the MNV genome at nucleotide position 6351, and primer HδVpolyA (5′ AGGCTGGGACCATGCCGGCCTTTTTTTTTTTTTTTT-TTTTTTTTTTTTTTTAAAATGCATCTAACT), matching the 3′ end of the MNV genome (italics), polyA tail, and part of the HδV ribozyme (underlined) were used to amplify the 3′ end of the MNV genome. The plasmid pFBrep5.1neoT7/NotI (25) was used as a template with primers HδV (5′ AAAGGCCGGCATGGTCCCAGC) encoding the 5′ end of the HδV ribozyme (underlined) and CAGDOWN (5′ CATATGTCCTTCCGAGTG) to amplify the HδV ribozyme–NotI region from this plasmid. The two PCR products were gel-purified and used in a fusion PCR with primers CAGDOWN and BspF then cloned into pCRBlunt and sequenced, to create a 1,158-bp BspI-NotI fragment encoding bases 6351–7382 of the MNV genome, a 30-bp polyA-tail, the HδV ribozyme immediately after the polyA-tail, and a unique NotI site.
The ApaI-BspEI region of the MNV genome (bases 1034–6350) was isolated from the pSport-1 full-length clone and cloned with the 3′ BspEI-NotI genome PCR fragment into ApaI-NotI digested pBluescriptIISK+ (Invitrogen). The resulting clone was isolated as an Apa-NotI fragment and along with the 5′ AgeI-ApaI PCR fragment, cloned into AgeI-NotI digested pFBTET to create the full length MNV clone pFBTET-MNV.
Recombinant Baculovirus Construction.
The pFBTET-MNV plasmid was used to create the Autographa californica nucleopolyhedrovirus bacmid (AcMNPV), pBacTET-MNV, in DH10Bac Escherichia coli as per manufacturers instructions (Invitrogen). The bacmid was purified by alkaline lysis extraction, transfected into Sf9 cells with lipofectin (Invitrogen) and grown at 27°C in TC100 medium supplemented with 10% FBS (Invitrogen). The resulting recombinant virus (BACTET-MNV) was propagated in Sf9 suspension culture, then concentrated by centrifugation in a microfuge for 20 min and resuspended in PBS. The viral titer was determined by plaque assay.
Infectious MNV Recovery.
HepG2 cells were seeded on collagen-coated 35-mm six-well trays and grown overnight. The cells were transduced with 100 pfu of BACTET-MNV and 100 pfu of BACTET-tTA per cell for 4 h then washed and incubated in fresh medium for 24 h. The HepG2 cells were freeze-thawed, and 1 ml of crude lysate used as inoculum for amplification of recombinant MNV (recMNV or MNV*) on RAW264.7 cells in 35-mm six-well trays. Passage and plaque assay of the recovered virus was undertaken by freeze–thaw and infection with crude lysate. HepG2, BHK-21, Cos-7, and HEK293T cells were seeded onto 35-mm six-well trays and grown overnight. FuGene HD (Roche, Basil, Switzerland) was used to transfect 1 μg of plasmid DNA per well and virus recovery on RAW264.7 cells undertaken as above.
Detection of Recombinant MNV by Immunofluorescence.
RAW264.7, HepG2, or HEK293T cells were seeded onto polylysine-coated cover slips and infected with recombinant MNV then incubated for 20 h. The cells were methanol-fixed then probed with monoclonal antibodies to MNV VPg, N-term, or capsid at 1/1,000. Goat anti-mouse FITC secondary antibody was used for detection, and the cover slips were treated with vectashield (Vector Laboratories, Burlingame, CA) containing DAPI. Background fluorescence was suppressed with Evans blue. Fluorescent images were observed on a Leica (Wetzlar, Germany) Leitz DMRB fluorescence microscope and captured with a Leica DFC300FX camera. Representative regions were cropped and overlays undertaken within Adobe Photoshop CS2 (Adobe Systems, Mountain View, CA).
Western Blot Detection of MNV Proteins.
RAW 264.7 or HEK293T cells were harvested and washed with PBS then subjected to SDS/PAGE analysis. The separated proteins were transferred to Immobilon membrane (Millipore, Billerica, MA) and probed with rabbit anti-MNV capsid polyclonal antibody (14) or anti-MNV N-term monoclonal antibody. Goat anti-rabbit or anti-mouse alkaline phosphatase antibodies (BioRad, Hercules, CA) were used as the secondary antibodies, and the blots were developed with NBT/BCIP or by ECL. The image was scanned with an HP scanner into Adobe Photoshop CS2 (Adobe Systems).
Sequencing the Recombinant MNV Genome.
A series of 15 overlapping RT-PCRs were performed to sequence all except the extreme termini of the recovered MNV genome (SI Fig. 5 and SI Table 1). The 3′ and 5′ termini were amplified by RACE (SI Fig. 6), the resulting clones were sequenced by using a Beckman CEQ sequencer (Beckman Coulter, Fullerton, CA), and sequences were analyzed by using the Lasergene suite of DNA analysis programmes (DNAStar, Madison, WI).
Recovery of a Marked Virus.
Base 1001 in the 191-bp region between the FseI and ApaI sites of the MNV genomic cDNA was selected for mutation from C to A to create an EcoRV restriction site. Primers MNV382–407 (5′ CGGAGGACGCTATGGATGCCAAGGAG) and primer ApaRV* (5′ TCGAAGGGCCCTTCGGCCTGCCATTCCCCGAAGATAGATaTCATCCA-GTTGGTC) containing the ApaI restriction site (underlined) and a mismatched base to create an EcoRV site (double underlined) via an A change at base 1001 (lowercase), were used to amplify the mutated region from the MNV genome. The PCR product was digested with ApaI and FseI and ligated directly into the pFBTETMNV clone to replace the parental sequence and create clone pFBTETMNV*. The clone was used to create a recombinant bacmid and recombinant baculovirus and perform HepG2 transduction and RAW cell recovery as described above, to create MNV*. RNA extraction, reverse transcription, and PCR with primers 3F and #R were performed as described above. Uninfected cells and reverse transcriptase negative controls were included. The resulting products for recMNV and MNV* were digested with EcoRV and analyzed by gel electrophoresis.
pMNV* Construction.
The pFBTETMNV* expression cassette, including minCMVpromoter, full-length genome, polyA tail, and ribozyme, was transferred into the plasmid pSP73. The 3′ end of the genome was isolated as a 3,474-bp fragment from the XhoI site at position 4596 on the MNV* genome to a HindIII site outside the ribozyme on pFBTETMNV* and ligated into pSP73. This clone was digested with XhoI and a 4,967-bp XhoI fragment containing the 5′end of the genome and minCMV promoter from pFBTETMNV* ligated into this site. Insert orientation was confirmed by digestion with SspI and BssHII.
pro–pol Cleavage Site Mutation.
The pro–pol region was modified by PCR mutagenesis to alter the glutamine residue in the recognition site to glycine and include an RsrII site for clone construction. Primers MNV5f (SI Table 1) and PPKOr 5′ GGAAGCATGGGcGGTCCgccGAACTCCAGAGCCTCAAGTGTG 3′ and primers MNV8r (SI Table 1) and PPKOf5′ CTGGAGTTCggcGGACCgCCCATGCTTCCCCGCCCCTCAGG 3′ were used to create two overlapping PCR products (Phusion DNA polymerase; New England Biolabs, Ipswich, MA) with RsrII cleavage sites (underlined). Sequences modified from the parental sequence are in lowercase. The PCR products were digested with RsrII, ligated together, gel-purified, and cloned into pCRBlunt. The clone was sequenced, digested with AatII, which flanks the pro–pol boundary, and inserted into AatII digested pFBTETMNV, and orientation of the insert confirmed by SfiI digestion. The modified region of the clone was transferred into the pMNV* vector as an XhoI fragment as described above.
Abbreviations
- CPE
- cytopathic effect
- HδV
- hepatitis delta virus
- HepG2
- human hepatocellular carcinoma cell line G2
- MNV
- murine norovirus
- pol
- DNA polymerase
- pro
- viral protease
- pol
- viral polymerase
- RACE
- rapid amplification of cDNA ends
- RAW264.7
- Murine macrophage cell line 264.7
- Sf9
- Spodoptera frugiperda cell line Sf9
- VPg
- MNV viral protein genomic.
Acknowledgments
We thank Rachel Skilton for fluorescence microscopy assistance and Sarah Garner for providing the VPg and N-term monoclonal antibodies. This work was supported in part by the New Zealand Marsden Fund, the University of Otago (V.K.W.), and Wellcome Trust Grant 069233.
Supporting Information
Adobe PDF - 00336Table1.pdf
Adobe PDF - 00336Table1.pdf
- Download
- 9.36 KB
Adobe PDF - 00336Fig6.pdf
Adobe PDF - 00336Fig6.pdf
- Download
- 234.71 KB
00336Fig4.jpg
- Download
- 825.66 KB
00336Fig5.jpg
- Download
- 154.29 KB
00336Fig7.jpg
- Download
- 127.39 KB
References
1
PS Mead, L Slutsker, V Dietz, LF McCaig, JS Bresee, C Shapiro, PM Griffin, RV Tauxe Emerg Infect Dis 5, 607–625 (1999).
2
IN Clarke, PR Lambden Topley and Wilson's Microbiology and Microbial Infections: Virology, eds BWJ Mahy, W ter Meulen (Hodder Arnold, London) Vol 2, 911–931 (2005).
3
RL Fankhauser, JS Noel, SS Monroe, T Ando, RIM Glass J Infect Dis 178, 1571–1578 (1998).
4
KY Green, RM Chanock, AZ Kapikian Fields Virology, eds DM Knipe, PM Howley (Lippincott Williams & Wilkins, Philadelphia), pp. 841–874 (2001).
5
AM Hutson, RL Atmar, MK Estes Trends Microbiol 12, 279–287 (2004).
6
GQ Liu, YY Zhang, Z Ni, T Yun, ZT Sheng, HL Liang, JG Hua, SM Li, QY Du, JP Chen J Virol 80, 6597–6602 (2006).
7
KO Chang, S Sosnovtsev, Q Wang, LJ Saif, KY Green J Virol 79, 1409–1416 (2005).
8
S Sosnovtsev, S Sosnovtseva, KY Green (Eur Soc Vet Virol Cent Vet Lab, Weybridge, UK), pp. 125–130 (1997).
9
S Sosnovtsev, KY Green Virology 210, 383–390 (1995).
10
M Asanaka, RL Atmar, V Ruvolo, SE Crawford, FH Neill, MK Estes Proc Natl Acad Sci USA 102, 10327–10332 (2005).
11
E Duizer, KJ Schwab, FH Neill, RL Atmar, MPG Koopmans, MK Estes J Gen Virol 85, 79–87 (2004).
12
SM Karst, CE Wobus, M Lay, J Davidson, HW Virgin Science 299, 1575–1578 (2003).
13
CE Wobus, LB Thackray, HW Virgin J Virol 80, 5104–5112 (2006).
14
CE Wobus, SM Karst, LB Thackray, KO Chang, SV Sosnovtsev, G Belliot, A Krug, KY Green, HW Virgin PLOS Biology 2, 2076–2084 (2004).
15
CC Hsu, LK Riley, HM Wills, RS Livingston Comp Med 56, 247–251 (2006).
16
SV Sosnovtsev, G Belliot, KO Chang, VG Prikhodko, LB Thackray, CE Wobus, SM Karst, HW Virgin, KY Green J Virol 80, 7816–7831 (2006).
17
G Belliot, SV Sosnovtsev, T Mitra, C Hammer, M Garfield, KY Green J Virol 77, 10957–10974 (2003).
18
SJ Blakeney, A Cahill, PA Reilly Virology 308, 216–224 (2003).
19
ME Hardy FEMS Microbiol Lett 253, 1–8 (2005).
20
BL Liu, GJ Viljoen, IN Clarke, PR Lambden J Gen Virol 80, 291–296 (1999).
21
BL Liu, IN Clarke, PR Lambden J Virol 70, 2605–2610 (1996).
22
CJ McCormick, DJ Rowlands, M Harris J Gen Virol 83, 383–394 (2002).
23
JP Condreay, SM Witherspoon, WC Clay, TA Kost Proc Natl Acad Sci USA 96, 127–132 (1999).
24
SV Sosnovtsev, M Garfield, KY Green J Virol 76, 7060–7072 (2002).
25
CJ McCormick, L Challinor, A Macdonald, DJ Rowlands, M Harris J Gen Virol 85, 429–439 (2004).
26
KS Harris, SR Reddigari, MJH Nicklin, T Hammerle, E Wimmer J Virol 66, 7481–7489 (1992).
27
SL Oliver, CA Batten, Y Deng, M Elschner, P Otto, A Charpilienne, IN Clarke, JC Bridger, PR Lambden J Clin Microbiol 44, 992–998 (2006).
28
CJ McCormick, D Brown, S Griffin, L Challinor, DJ Rowlands, M Harris J Gen Virol 87, 93–102 (2006).
Information & Authors
Information
Published in
Classifications
Copyright
© 2007 by The National Academy of Sciences of the USA.
Submission history
Received: January 12, 2007
Published online: June 26, 2007
Published in issue: June 26, 2007
Keywords
Acknowledgments
We thank Rachel Skilton for fluorescence microscopy assistance and Sarah Garner for providing the VPg and N-term monoclonal antibodies. This work was supported in part by the New Zealand Marsden Fund, the University of Otago (V.K.W.), and Wellcome Trust Grant 069233.
Notes
This article is a PNAS Direct Submission. M.K.E. is a guest editor invited by the Editorial Board.
This article contains supporting information online at www.pnas.org/cgi/content/full/0700336104/DC1.
Authors
Competing Interests
The authors declare no conflict of interest.
Metrics & Citations
Metrics
Citation statements
Altmetrics
Citations
If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download.
Cited by
Loading...
View Options
View options
PDF format
Download this article as a PDF file
DOWNLOAD PDFGet Access
Login options
Check if you have access through your login credentials or your institution to get full access on this article.
Personal login Institutional LoginRecommend to a librarian
Recommend PNAS to a LibrarianPurchase options
Purchase this article to get full access to it.