Lesion Development and Replication Kinetics During Early Infection in Cattle Inoculated With Vesicular Stomatitis New Jersey Virus Via Scarification and Black Fly (Simulium vittatum) Bite

A plastic bifurcated needle (Duotip Tests, Lincoln Diagnostics, Decatur, IL) served as the inoculating tool and was used as previously described.¹⁴ The line of scarification was approximately 8 cm long and located on the lateral aspect of the limbs, on the haired skin of the CB immediately proximal to the thick nonhaired skin (Fig. 1 ). The inoculum contained 10⁷ TCID₅₀ of VSVNJ in 50 μl of cell culture media with 1% antibiotic/antimycotic as previously described;¹⁴ virus-free medium was used as the negative control. The scarification site was created with approximately 25 skin pricks, and then the inoculum or virus-free medium was applied with a pipette. The procedure was repeated, with 25 additional skin pricks and application of additional medium. In experimental animals, the viral inoculum was applied to the right front and rear CB, whereas the left front and rear CB were scarified and treated with virus-free medium. In the mock-inoculated animal, the right front and rear CB were scarified and treated with virus-free medium, whereas the left front and rear CB were left intact. The mock-inoculated animal was euthanatized at 24 HPI, and the virus-infected animals were euthanatized at 12, 24, 48, 72, 96, and 120 HPI.

Inoculation by fly bite was done as in previous studies.⁸ Briefly, black flies were intrathoracically injected, as previously described,⁷ with approximately 1 μl containing 10⁷ TCID₅₀ of VSNJV. Infected black flies were allowed to feed on the designated CB of 4 animals and on sites on the necks of 3 animals. For the CB animals, 30 caged VSNJV-infected black flies were allowed to feed for approximately 20 minutes at the lateral aspect of the right front and rear CB (Fig. 2 ). Cages were placed in a position to allow flies to access either haired or glabrous CB skin. In general, flies probed or bit in the haired skin, approximately 1 cm proximal to the thick glabrous CB skin. The same number of uninfected black flies was allowed to feed for approximately 20 minutes at the lateral aspect of the left front and rear CB. These 4 FB CB experimental animals were euthanatized at 24, 48, 72, and 96 HPI. One mock-inoculated animal was treated with uninfected black flies on the right CB, with no treatment at the left CB, and was euthanatized at 24 HPI. The same method was used in the group of the 3 neck-inoculated animals. Infected black flies were allowed to feed on the right side of the neck, and uninfected black flies were allowed to feed on the left side of the neck. Of these 3 steers inoculated in the neck, 1 animal was euthanatized at 24 HPI and 2 animals at 72 HPI.

As a quality control for the fly bite inoculation, all flies were tested for the presence or absence of mammalian blood by SYBR-Green real-time polymerase chain reaction (RT-PCR) for mammalian DNA (Power SYBR Green PCR Master Mix ABI 4367659) after feeding on cattle. Briefly, nucleic acid was extracted from each individual fly as described below for tissues. RT-PCR was conducted using primers designed specifically to target the 16s mammalian recombinant DNA gene. Forward primer sequence was 5′ CCTGTTTACCAAAAACATCAC 3′ and reverse primer sequence 5′ AYTGTCGATAKGRACTCTWRARTAG 3′ (Invitrogen, Carlsbad, CA). Primers were used at a final concentration of 300 nM per 25 µl reaction. The reaction was performed using 8 µl (per 25 µl reaction) of Power SYBR Green PCR Master Mix (Applied Biosystems 4367659). The amount of nucleic acid template was 2.5 µl per reaction, which was performed on an ABI 7000 sequence detection system using the following cycling conditions: 94°C for 2.5 minutes, and 40 cycles of 94°C for 45 seconds, 50°C for 45 seconds, 72°C for 60 seconds, and a final 72°C hold for 5 minutes. After the RT-PCR, a melt curve was performed to detect the Tm of SYBR Green-bound DNA products. Products with a Tm of approximately 80°C were considered positive for mammalian DNA.

The blood meal analysis was done in all flies used in this study and determined that approximately 20% of the flies (which corresponds to about 6 flies) fed during the period of mock and viral inoculation (data not shown).

Samples collected immediately after euthanasia included lateral aspect of all 4 CB and potential lesions extending from the original site of the inoculation, right and left neck skin, and local draining lymph nodes (LN) including prescapular, axillary, popliteal, and prefemoral. Spleen, tongue, and tonsils were also collected. Approximately 30 mg of collected tissues were quick-frozen in liquid nitrogen for later transfer to –70°C for virus isolation (VI) and reverse transcriptase RT-PCR (rRT-PCR) for detection of live virus and viral nucleic acid respectively. Additionally, serum was collected just prior to euthanasia for VI and rRT-PCR. Sections <1 cm thick of the remaining tissues were fixed in a 10% buffered formalin solution, for histopathology, immunohistochemistry, and in situ hybridization. The whole neck and CB skin at and around fly cage location and scarified areas were collected and trimmed for histopathologic evaluation. For each of these sites, 4 tissue cassettes were collected, each with 3 samples of epidermis. All 4 hematoxylin and eosin (HE)–stained slides from these blocks (equaling at least 12 sections from each site) were examined; a minimum of 2 slides (6 sections) were selected, and corresponding sections were analyzed by ISH and IHC. A semiquantitative score was attributed to the ISH and IHC slides: negative (N) was assigned for no signal, + for minimal to mild or faint signal, ++ for a moderately discrete but localized signal, and +++ for a prominent and diffuse signal.

Tissues were thawed and immediately macerated by adding two 5-mm stainless steel beads (Qiagen, Catalog No. 69989) and 0.9 ml of MEM-25mM HEPES and then were shaken in a TissueLyser bead beater (Qiagen) for 2 minutes at a frequency of 22 per second. After maceration, 50 μl of sample was transferred to 96-well plates (King Fisher No. 97002540) containing 150 μl of lysis/binding solution. RNA was then extracted using Ambion’s MagMax-96 Viral RNA Isolation Kit (Ambion, catalog No. 1836) on a King Fisher-96 Magnetic Particle Processor (Thermo Electron Corp.). Briefly, after the initial 5-minute lysis/binding step, the RNA sample underwent a series of 4 washing steps, a drying step, and a final elution. RNA was eluted in a final volume of 25 μl. At each of the above steps, RNA was magnetically bound to the beads contained in the lysis/binding solution and was transferred to the different extraction solutions. The extracted RNA was analyzed by rRT-PCR using 2.5 μl of RNA on the ABI 7000 as described below. The remaining macerated tissue was clarified (1000 g for 2 minutes at 4°C), and the supernatant was cleared of possible bacterial contamination using centrifuge tube filters (Spin-X, Costar). Samples were then stored at –70°C for VI. The rRT-PCR was performed using primers and probe designed specifically for the nucleocapsid region of isolate used for the inoculations (95COB). Forward primer sequence was 5′ GCACTTCCTGATGGGAAATCA 3′ and reverse primer sequence 5′ GGGAAGCCATTTATCATCCTCA 3′ (Invitrogen, Carlsbad, CA), and a 6-carboxyfluorescein (6-FAM)–labeled probe 5′ ACCCTGACCGTTCTG 3′ (Applied Biosystems, Foster City, CA) was used. Primers were used at a final concentration of 300 nM, and probes were used at 100 nM per 25 μl reaction. The reaction was performed using the Taqman EZ RT-PCR Core Reagents (Applied Biosystems N808-0236) at the following volumes/concentrations per 25 µL reaction: 5 μl of 5× buffer, 3 μl of 25 mM Mn (OAc)₂, 3 μl of dNTPs (combined 1:1:1:1 by volume), 1 μl of rTth, 0.25 μl of Amperase, and 9.7 μl of H₂0. The amount of RNA template was 2.5 µl per reaction, which was performed on an ABI 7000 sequence detection system using the following cycling conditions: 60°C for 25 minutes, 95°C for 2 minutes, and 40 cycles of 95°C for 10 seconds and 60°C for 1 minute. Results were expressed as cycle threshold (CT) values. A CT value <40 was considered positive for the presence of virus. Negative control consisted of all rRT-PCR reagents and water in place of template.

A 250-µl aliquot of the supernatant described above was placed in individual T-25 tissue-culture flasks containing a monolayer of VERO cells. The virus was allowed to adsorb for 1 hour at 37°C on a rocker plate, followed by addition of 5 ml of maintenance media with 3 subsequent days of incubation at the same temperature. Flasks were examined under an inverted microscope to observe cytopathic effect (CPE) at 24, 48, and 72 HPI. After 72 HPI, CPE-positive samples were stored at –70°C for rRT-PCR, and 250 µl of supernatant from each CPE-negative sample was transferred to a new culture flask (second passage). After 72 HPI, all flasks (CPE positive or negative) from the second passage and all CPE-positive materials from the first passage were processed for rRT-PCR.

All formalin fixed samples were routinely embedded in paraffin, cut at 3- to 4-μm thickness, and stained with HE for histological examination to assess inflammatory reaction, extent of microvesicle formation, and any other pathologic changes.

For IHC, deparaffinized sections were subjected to antigen retrieval with 80 μg/ml proteinase K for 15 minutes at 37°C, followed by blocking of nonspecific epitopes. Then samples were incubated overnight at 4°C with primary antibody, anti-VSNJV polyclonal, a mouse hyperimmune ascitic fluid (kindly provided by Dr. Robert Tesh, Department of Pathology, Medical Branch, University of Texas, Galveston), at a dilution of 1:1800. Primary antibody was followed by incubation with an alkaline phosphatase-linked polymer system (LabVision). The reaction was revealed using Vector Red chromogen. The slides were lightly counterstained with Mayer’s hematoxylin and then cover-slipped using Permount for permanent record. For each IHC protocol, anti-VSV antibody was applied to a left (mock-inoculated side) CB or neck skin and popliteal or prefemoral lymph nodes for negative control. Additionally, each IHC protocol had a slide containing a section of CB skin with a recognizable histological vesicular lesion or a lymph node draining a CB with lesion. For these sections, normal mouse serum was used instead of the anti-VSV antibody. Selected lymph node sections were additionally subjected to an IHC protocol to highlight dendritic cells, using the same procedure outlined above, except that the primary antibody was anti-CD1b (monoclonal ascites fluid antibody; VMRD catalog No. TH97A) at a dilution of 1:100.

Negative sense riboprobes were used to detect positive-stranded (replication) viral RNA. The riboprobes consisted of 410 bases corresponding to the nucleoprotein (N) gene using methods previously described.² The following primers were used to produce the N gene construct: 5′-GAA GAT GGT CTT GAC TTC TTT G-3′ (forward) and 5′-CGA GTT GAT CTT AGC AAG AGT G-3′ (reverse). The N gene segment was cloned and amplified in a pGEM-4Z vector (Promega, Madison, WI). The vector was digested with BglII restriction enzyme to create a template for the negative sense probe, and digoxigenin-labeled nucleotides were added during transcription of the probe. Incorporation of the digoxigenin was verified by dot blot. Sections from tissues that were positive either on VI or on rRT-PCR were processed for ISH as previously described.¹ Tissue sections were treated with 100 μg/ml proteinase K solution and then incubated with the negative sense VSNJV riboprobe (corresponding to the N gene) at 42°C for 12 hours, followed by incubation with antidigoxigenin conjugated to alkaline phosphatase (1:300). Negative controls included noninfected tissues. The reaction was visualized using tetrazolium-based (NBT-BCIP) chromogen. The slides were lightly counterstained with Mayer’s hematoxylin then cover-slipped with Permount for permanent record.

None of the animals inoculated in the neck skin developed fever or any other clinical sign of disease. They had only multiple small (approximately 1 mm in diameter) focal areas of hyperemia at the site of FB in both right and left (infected and uninfected FB) neck skin.

Histologically, the superficial dermis had minimal to mild foci of inflammatory infiltrates in the right and left neck skin of all 3 steers. Dermal infiltrates were slightly more severe in the animal euthanatized at 24 HPI and were composed of small numbers of macrophages with fewer neutrophils. There were no lesions in the epidermis, except for the animal euthanatized at 24 HPI that had scant small (approximately 0.5 mm in diameter) focal areas of epidermal necrosis within the FB region in both right and left sides.

There were very limited positive results by any of the techniques used to detect virus in these tissues. Inoculation site skin in the 24 HPI animals was positive by both VI and rRT-PCR on the right (infected) side. At 72 HPI, 1 of the 2 euthanatized animals at this time had inoculated neck skin positive on rRT-PCR only, with no viral detection with VI, ISH, or IHC. At no time were the tissues of any of these 3 animals positive by IHC or ISH, nor was any evidence of epidermal disruption seen on HE. All other tissues as well as serum collected from these animals were consistently negative for the presence of virus by all techniques (data not shown).

All experimentally infected animals in this group developed fever (>39.2°C) and mild depression between 24 and 48 HPI. No other clinical abnormalities were noted. In the case of the SC-inoculated animals, at 12 HPI, the only lesion was a mild hyperemia along the line of inoculation. Subtle gross lesions, including mild edema and hyperemia, were present at the site of inoculation at 24 HPI in both SC- and FB-inoculated animals. At 48 HPI there was moderate edema and hyperemia restricted to the site of SC. However, the FB-inoculated steer euthanatized at the same time had much more prominent hyperemia and swelling of the right (infected) rear CB, with a few 1- to 2-cm diameter, dark and circumscribed areas of ulcerations that coincided with the sites where the flies were feeding. In addition, in a region beyond where the cage was positioned, in the right rear interdigital space, this animal had marked vesicular formation, characterized by a focally extensive white and elevated area that exuded serous fluid when cut. No gross lesions were present at 48 HPI in the right (infected) front FB-inoculated CB, and analysis of fly blood meals revealed that no flies fed on this foot. At 72 and 96 HPI, the right CB infected by SC had moderate hyperemia and edema, multifocal areas of hemorrhage, and multiple 2- to 3-mm ulcerations corresponding to zones of SC. A serous fluid frequently oozed from the small ulcers. However, at the same time points (72 and 96 HPI), the lesions in the FB-inoculated animals were more severe, with diffuse edema, hyperemia, and a few dark 2- to 3-cm diameter ulcerated areas corresponding to where fly cages were positioned at the time of inoculation. In these FB-inoculated animals, lesions extended far beyond the site of FB with vesicles reaching the interdigital space. At 120 HPI, the SC lesions were similar to or slightly more severe than those seen in the 96 HPI SC steer. In the mock-inoculated animals, CBs developed a mild hyperemia at the site of SC or FB at 24 HPI and occasionally at 48 HPI. The 96 HPI FB and the 120 HPI SC had moderately to markedly enlarged popliteal and prescapular LNs.

Only 1 SC-inoculated steer was euthanatized at 12 HPI. In this animal in both right and left (virus inoculated and mock inoculated, respectively) CB, small areas of serocellular crusting with underlying epidermal disruption developed, characterized by poorly defined focal eosinophilic areas with loss of definition of cellular borders in the upper strata spinosum and granulosum. There was focal loss of the epidermis at the areas of scarification (Fig. 3a ). There was mild to moderate focal neutrophilic exocytosis in the epidermis. The superficial dermis had focal perivascular infiltration of numerous neutrophils and fewer macrophages.

At 24 HPI, both the SC- and FB-inoculated animals presented large coalescing areas of mild to moderate intercellular edema (spongiosis) with stretching of intercellular bridges and shrunken keratinocytes in the deep stratum spinosum (Fig. 4a). Cells from the strata basale and granulosum were consistently spared at this time. There was mild neutrophilic exocytosis throughout the affected epidermis, with moderate numbers of neutrophils and macrophages around perivascular areas of the superficial dermis.

At 48 HPI in the SC-inoculated animal, the narrow zone of inoculated haired CB skin had necrosis of epithelium of the epidermis and hair follicles with accompanying neutrophilic infiltration; the thicker nonhaired skin closer to the hoof had severe intercellular edema and hypereosinophilic, pyknotic, and shrunken keratinocytes limited to the stratum spinosum (Fig. 5a). Multifocal areas of this thick glabrous skin formed cavitations partially filled with numerous neutrophils, fewer macrophages, cell debris, and acantholytic cells. Similar to what was observed at 24 HPI, the strata basale and granulosum were consistently spared. The superficial dermis had moderate perivascular to interstitial infiltration of numerous macrophages and neutrophils, with fewer lymphocytes.

The FB-inoculated steer at 48 HPI had minimal lesions in the right front CB, whereas the right rear CB had severe epidermal disruption affecting a much larger zone of haired skin. These lesions were more severe than those observed in the SC-inoculated animal at this time. Hair follicles were frequently effaced by marked epidermal necrosis and accumulation of degenerated neutrophils. In the nonhaired thick skin (located immediately distal the haired skin but not in contact with the flies), there were extensive areas of full-thickness necrosis from the stratum basale to the stratum granulosum, with much greater damage than seen in the SC-inoculated animal at this time point. Within the stratum spinosum were multiple large coalescing cavitations filled with numerous neutrophils, few macrophages, cell debris, and occasional acantholytic cells. There was cleft formation at the stratum basale, with separation of this layer from the stratum spinosum. The dermis had moderate to severe perivascular to interstitial infiltration of numerous macrophages and neutrophils, with fewer lymphocytes and infrequent mast cells.

By 72 HPI, there was extensive necrosis of the thick nonhaired skin at the CB of the SC-inoculated animal, characterized by large pale eosinophilic areas, with loss of cellular detail (Fig. 6a). Areas of necrosis were centered in the stratum spinosum, spared the stratum basale, and extended to but did not efface the stratum granulosum. Numerous neutrophils infiltrated through the intercellular spaces around necrotic keratinocytes and filled areas where there was loss of keratinocytes. The dermis had moderate to severe perivascular to interstitial infiltration of numerous macrophages and neutrophils, with fewer lymphocytes. The animal inoculated by FB had lesions similar to those observed in the FB-inoculated steer at 48 HPI, with more extensive areas of necrosis and loss of epidermis.

At 96 HPI, epidermal lesions in the animals inoculated by either method were similar. There were full-thickness necrosis and cleft formations at the level under the stratum basale, with frequent loss of the entire epidermis of the CB (ulceration).

At 120 HPI, lesions were similar to those observed at 96 HPI but showed evidence of initial epidermal regeneration, in which the basal layer contained numerous and prominent digitiform projections composed of hyperplastic epithelial cells extending into the dermis.

The lymph nodes draining the right (inoculated) CBs presented with nonspecific reactive changes. No difference was observed between SC- and FB-inoculated animals. Mild paracortical hyperplasia started at 24 HPI, with gradual development of more paracortical and also medullary cord hyperplasia from 72 to 120 HPI.

All results from animals inoculated in the CBs are shown online in a supplementary table (to view online supplement, please go to http://www.vet.sagepub.com/supplement). Detection of VSNJV by VI and rRT-PCR was restricted to the site of inoculation and draining LNs. All samples from mock-inoculated animals and left mock-inoculated CB (on the left side), tongue, tonsil, spleen, and serum from experimental animals were consistently negative by these techniques in all animals using either method of inoculation. For the right CBs (inoculated side), positive VI and low rRT-PCR CT values were positive at all times post inoculation, from 12 to 120 HPI, in both FB- and SC-inoculated groups of animals. However, the right front CB from a steer sampled at 48 HPI, where inoculation with infected black flies was attempted, was negative on VI and only weakly positive (high CT value) on the rRT-PCR. Flies from this site were negative for mammalian DNA, indicating that flies fed very poorly, if at all. For the draining lymph nodes of inoculated animals, live virus was isolated as early as 12 HPI in a scarified animal and no later than 72 HPI in both animal groups. The rRT-PCR results from the draining lymph nodes tended to have much higher CT values (lesser amount of virus) than the inoculated CBs.

Using the negative sense probe, which is complementary to the viral messenger RNA (mRNA) and antigenome strand (which are both sense/positive strands), for the N gene resulted in segmentally diffuse staining of the keratinocyte cytoplasm in the inoculated CBs. The SC-inoculated steer at 12 HPI had ISH signal from the stratum basale extending up into the midstratum spinosum (Fig. 3b). Signal distribution and intensity varied from darkly distinct small foci at 12 HPI to extensive coalescing large areas at 24 HPI (Fig. 4b) for both methods of inoculation. The signal had the same intensity at 48 HPI, but the positive keratinocytes were scattered within (Fig. 5b) or located around the periphery of necrotic areas (vesicle) for both SC and FB animals. At 72 HPI, both SC- and FB-inoculated animals had positive keratinocytes with fainter but diffuse signal throughout the cytoplasm (Fig. 6b). When we compared the 2 methods of inoculation at 48 HPI, the location of ISH labeling was distinct between SC- (Fig. 7 ) and FB-inoculated (Fig. 8 ) animals. For both, the ISH signal was scattered within the stratum spinosum and restricted to the CB epithelium. However, in the FB-inoculated steer, ISH signal was deeper, occurring in the stratum basale of the CB and expanding beyond the fly-feeding area into the interdigital region, with cleft formation under the level of the stratum basale of both CB and interdigital skin (Fig. 8). ISH-positive keratinocytes were present throughout the necrotic epidermis. At 96 HPI, SC- and FB-inoculated animals had faint diffuse signal in the cytoplasm of keratinocytes, as did the SC-inoculated animal at 120 HPI. Positivity was multifocal and located more frequently at the periphery of necrotic areas.

Use of a negative sense probe to detect replicating virus in the draining LNs highlighted scattered large cells with abundant cytoplasm, morphology suggestive of dendritic cells or macrophages, in subcapsular areas of cortex and paracortex regions at 24 HPI only in both SC- and FB-inoculated animals (Fig. 9 ).

There was signal representing viral protein in the cytoplasm and in the plasma membrane of keratinocytes in the inoculated CB. This signal was consistently restricted to the epidermis. Epidermal location of the signal followed in a similar fashion with the development of the histological lesion described above, except for the 12 HPI scarified steer, which had IHC signal from the stratum basale up through the midstratum spinosum (similar to the ISH staining). The IHC signal was present at later time points than ISH signal but was otherwise similar in the epidermis, yet it had many similarities to that seen with negative sense riboprobe ISH. That is, staining intensity varied from focal and intense, being restricted to small foci at 12 HPI (Fig. 3c) to more extensive, affecting large coalescing areas from 24 until 72 HPI (Figs. 4c, 5c, and 6c), after which it became fainter and more localized at 96 and 120 HPI. However, the patterns of IHC and ISH diverged in the lymph nodes. In contrast to what was observed with ISH, there was IHC positivity until 120 HPI in the draining lymph nodes, with positive cells in the cortical subcapsular regions at 24 HPI and in perifollicular and follicular regions at 48, 72 (Fig. 10 ), 96, and 120 HPI. On sections of 24 HPI lymph nodes, IHC specific for dendritic cells (anti-CD1b antibody) highlighted the same types of cells in the same areas as were positive by ISH at 24 HPI (data not shown).