Expression Profile and Regulatory Properties of m6A-Modified circRNAs in the Longissimus Dorsi of Queshan Black and Large White Pigs
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection, Sequencing, and m6A-circRNA Prediction Analysis
2.2. Putative m6A-circRNA Sequence Analysis, Open Reading Frame (ORF) and Internal Ribosome Entry Site (IRES) Prediction
2.3. Functional Enrichment Analysis of m6A-circRNA Parent and Target Genes
2.4. Construction of the m6A-circRNA–miRNA–mRNA Network
2.5. m6A RNA Methylation Quantification (Me-RIP)
2.6. MeRIP-qPCR
2.7. Statistical Analysis
3. Results
3.1. Identification and Characterization of m6A-circRNAs in the Longissimus Dorsi of Queshan Black and Large White Pigs
3.2. Sequence Analysis and Coding Ability Prediction of Putative m6A-circRNAs
3.3. Construction of Regulatory Network of Putative m6A-circRNAs
3.4. GO and KEGG Annotation and Enrichment Analysis of Putative m6A-circRNAs
3.5. GO and KEGG Annotation and Enrichment Analysis of Target Genes
3.6. Analysis of the Expression Pattern of m6A-circRNAs in the Longissimus Dorsi of Queshan Black and Large White Pigs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Muñoz, M.; García-Casco, J.M.; Caraballo, C.; Fernández-Barroso, M.; Sánchez-Esquiliche, F.; Gómez, F.; Rodríguez, M.D.C.; Silió, L. Identification of candidate genes and regulatory factors underlying intramuscular fat content through longissimus dorsi transcriptome analyses in heavy iberian pigs. Front. Genet. 2018, 9, 608. [Google Scholar] [CrossRef] [PubMed]
- Swindle, M.M.; Makin, A.; Herron, A.J.; Clubb, F.J., Jr.; Frazier, K.S. Swine as models in biomedical research and toxicology testing. Vet. Pathol. 2012, 49, 344–356. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sanger, H.L.; Klotz, G.; Riesner, D.; Gross, H.J.; Kleinschmidt, A.K. Viroids are single-stranded covalently closed circular RNA molecules existing as highly base-paired rod-like structures. Proc. Natl. Acad. Sci. USA 1976, 73, 3852–3856. [Google Scholar] [CrossRef] [PubMed]
- Qu, S.; Yang, X.; Li, X.; Wang, J.; Gao, Y.; Shang, R.; Sun, W.; Dou, K.; Li, H. Circular RNA: A new star of noncoding RNAs. Cancer Lett. 2015, 365, 141–148. [Google Scholar] [CrossRef] [PubMed]
- Jeck, W.R.; Sorrentino, J.A.; Wang, K.; Slevin, M.K.; Burd, C.E.; Liu, J.; Marzluff, W.F.; Sharpless, N.E. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA 2013, 19, 141–157. [Google Scholar] [CrossRef] [Green Version]
- Legnini, I.; Di Timoteo, G.; Rossi, F.; Morlando, M.; Briganti, F.; Sthandier, O.; Fatica, A.; Santini, T.; Andronache, A.; Wade, M.; et al. Circ-ZNF609 is a circular RNA that can be translated and functions in myogenesis. Mol. Cell 2017, 66, 22–37.e29. [Google Scholar] [CrossRef] [Green Version]
- Zhou, B.; Yang, H.; Yang, C.; Bao, Y.L.; Yang, S.M.; Liu, J.; Xiao, Y.F. Translation of noncoding RNAs and cancer. Cancer Lett. 2021, 497, 89–99. [Google Scholar] [CrossRef]
- Chen, C.Y.; Sarnow, P. Initiation of protein synthesis by the eukaryotic translational apparatus on circular RNAs. Science 1995, 268, 415–417. [Google Scholar] [CrossRef]
- Feng, X.; Zhao, J.; Li, F.; Aloufi, B.H.; Alshammari, A.M.; Ma, Y. Weighted gene co-expression network analysis revealed that circMARK3 is a potential circRNA affects fat deposition in buffalo. Front. Vet. Sci. 2022, 9, 946447. [Google Scholar] [CrossRef]
- Wang, J.; Chen, J.F.; Ma, Q.; Mo, D.L.; Sun, J.J.; Ren, Q.L.; Zhang, J.Q.; Lu, Q.X.; Xing, B.S. Identification and characterization of circRNAs related to meat quality during embryonic development of the longissimus dorsi muscle in two pig breeds. Front. Genet. 2022, 13, 1019687. [Google Scholar] [CrossRef]
- Liu, Y.; Dou, Y.; Qi, K.; Li, C.; Song, C.; Li, X.; Li, X.; Qiao, R.; Wang, K.; Han, X. CircSETBP1 acts as a miR-149-5p sponge to promote intramuscular fat deposition by regulating CRTCs. J. Agric. Food Chem. 2022, 70, 12841–12851. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Mason, C.E. The pivotal regulatory landscape of RNA modifications. Annu. Rev. Genom. Hum. Genet. 2014, 15, 127–150. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Fan, X.; Mao, M.; Song, X.; Wu, P.; Zhang, Y.; Jin, Y.; Yang, Y.; Chen, L.L.; Wang, Y.; et al. Extensive translation of circular RNAs driven by N(6)-methyladenosine. Cell Res. 2017, 27, 626–641. [Google Scholar] [CrossRef] [Green Version]
- Rong, D.; Wu, F.; Lu, C.; Sun, G.; Shi, X.; Chen, X.; Dai, Y.; Zhong, W.; Hao, X.; Zhou, J.; et al. M6A modification of circHPS5 and hepatocellular carcinoma progression through HMGA2 expression. Mol. Ther. Nucleic Acids 2021, 26, 637–648. [Google Scholar] [CrossRef]
- Liang, L.; Zhu, Y.; Li, J.; Zeng, J.; Wu, L. ALKBH5-mediated m6A modification of circCCDC134 facilitates cervical cancer metastasis by enhancing HIF1A transcription. J. Exp. Clin. Cancer Res. 2022, 41, 261. [Google Scholar] [CrossRef] [PubMed]
- Yin, R.; Yin, R.; Bai, M.; Fan, Y.; Wang, Z.; Zhu, Y.; Zhang, Q.; Hui, T.; Shen, J.; Feng, S.; et al. N6-Methyladenosine modification (m6A) of circRNA-ZNF638 contributes the induced activation of SHF stem cells through miR-361-5p/Wnt5a axis in cashmere goats. Anim. Biosci. 2022, 36, 555–569. [Google Scholar] [CrossRef] [PubMed]
- Dou, Y.; Qi, K.; Liu, Y.; Li, C.; Song, C.; Wei, Y.; Zhang, Z.; Li, X.; Wang, K.; Li, X.; et al. Identification and functional prediction of long non-coding RNA in longissimus dorsi muscle of Queshan Black and Large White pigs. Genes 2023, 14, 197. [Google Scholar] [CrossRef]
- Qi, K.; Liu, Y.; Li, C.; Li, X.; Li, X.; Wang, K.; Qiao, R.; Han, X. Construction of circRNA-related ceRNA networks in longissimus dorsi muscle of Queshan Black and Large White pigs. Mol. Genet. Genom. MGG 2022, 297, 101–112. [Google Scholar] [CrossRef]
- Stothard, P. The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences. Biotechniques 2000, 28, 1102–1104. [Google Scholar] [CrossRef] [Green Version]
- Zhong, S.; Feng, J. CircPrimer 2.0: A software for annotating circRNAs and predicting translation potential of circRNAs. BMC Bioinform. 2022, 23, 215. [Google Scholar] [CrossRef]
- Granados-Riveron, J.T.; Aquino-Jarquin, G. The complexity of the translation ability of circRNAs. Biochim. Et Biophys. Acta 2016, 1859, 1245–1251. [Google Scholar] [CrossRef]
- Zhao, J.; Wu, J.; Xu, T.; Yang, Q.; He, J.; Song, X. IRESfinder: Identifying RNA internal ribosome entry site in eukaryotic cell using framed k-mer features. J. Genet. Genom. 2018, 45, 403–406. [Google Scholar] [CrossRef]
- Enright, A.J.; John, B.; Gaul, U.; Tuschl, T.; Sander, C.; Marks, D.S. MicroRNA targets in Drosophila. Genome Biol. 2003, 5, R1. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kertesz, M.; Iovino, N.; Unnerstall, U.; Gaul, U.; Segal, E. The role of site accessibility in microRNA target recognition. Nat. Genet. 2007, 39, 1278–1284. [Google Scholar] [CrossRef] [PubMed]
- Krüger, J.; Rehmsmeier, M. RNAhybrid: MicroRNA target prediction easy, fast and flexible. Nucleic Acids Res. 2006, 34, W451–W454. [Google Scholar] [CrossRef]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene ontology: Tool for the unification of biology. The Gene Ontology Consortium. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [Green Version]
- Kanehisa, M.; Sato, Y.; Kawashima, M.; Furumichi, M.; Tanabe, M. KEGG as a reference resource for gene and protein annotation. Nucleic Acids Res. 2016, 44, D457–D462. [Google Scholar] [CrossRef] [Green Version]
- Fahlgren, N.; Howell, M.D.; Kasschau, K.D.; Chapman, E.J.; Sullivan, C.M.; Cumbie, J.S.; Givan, S.A.; Law, T.F.; Grant, S.R.; Dangl, J.L.; et al. High-throughput sequencing of Arabidopsis microRNAs: Evidence for frequent birth and death of MIRNA genes. PLoS ONE 2007, 2, e219. [Google Scholar] [CrossRef] [PubMed]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Zhang, H.; Wang, Y.; Li, Y.; Wang, Y.; Zhu, J.; Lin, Y. Chi-circ_0006511 positively regulates the differentiation of goat intramuscular adipocytes via novel-miR-87/CD36 axis. Int. J. Mol. Sci. 2022, 23, 12295. [Google Scholar] [CrossRef]
- Li, B.; He, Y.; Wu, W.; Tan, X.; Wang, Z.; Irwin, D.M.; Wang, Z.; Zhang, S. Circular RNA profiling identifies novel circPPARA that promotes intramuscular fat deposition in pigs. J. Agric. Food Chem. 2022, 70, 4123–4137. [Google Scholar] [CrossRef]
- Zhang, R.M.; Pan, Y.; Zou, C.X.; An, Q.; Cheng, J.R.; Li, P.J.; Zheng, Z.H.; Pan, Y.; Feng, W.Y.; Yang, S.F.; et al. CircUBE2Q2 promotes differentiation of cattle muscle stem cells and is a potential regulatory molecule of skeletal muscle development. BMC Genom. 2022, 23, 267. [Google Scholar] [CrossRef]
- Chen, L.; Wang, C.; Sun, H.; Wang, J.; Liang, Y.; Wang, Y.; Wong, G. The bioinformatics toolbox for circRNA discovery and analysis. Brief. Bioinform. 2021, 22, 1706–1728. [Google Scholar] [CrossRef] [PubMed]
- Das, A.; Sinha, T.; Mishra, S.S.; Das, D.; Panda, A.C. Identification of potential proteins translated from circular RNA splice variants. Eur. J. Cell Biol. 2023, 102, 151286. [Google Scholar] [CrossRef] [PubMed]
- Das, A.; Rout, P.K.; Gorospe, M.; Panda, A.C. Rolling circle cDNA synthesis uncovers circular RNA splice variants. Int. J. Mol. Sci. 2019, 20, 3988. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Lu, Z.; Gomez, A.; Hon, G.C.; Yue, Y.; Han, D.; Fu, Y.; Parisien, M.; Dai, Q.; Jia, G.; et al. N6-methyladenosine-dependent regulation of messenger RNA stability. Nature 2014, 505, 117–120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, Y.; Hsu, P.J.; Chen, Y.S.; Yang, Y.G. Dynamic transcriptomic m(6)A decoration: Writers, erasers, readers and functions in RNA metabolism. Cell Res. 2018, 28, 616–624. [Google Scholar] [CrossRef] [Green Version]
- Du, A.; Li, S.; Zhou, Y.; Disoma, C.; Liao, Y.; Zhang, Y.; Chen, Z.; Yang, Q.; Liu, P.; Liu, S.; et al. M6A-mediated upregulation of circMDK promotes tumorigenesis and acts as a nanotherapeutic target in hepatocellular carcinoma. Mol. Cancer 2022, 21, 109. [Google Scholar] [CrossRef]
- Fan, H.N.; Chen, Z.Y.; Chen, X.Y.; Chen, M.; Yi, Y.C.; Zhu, J.S.; Zhang, J. METTL14-mediated m(6)A modification of circORC5 suppresses gastric cancer progression by regulating miR-30c-2-3p/AKT1S1 axis. Mol. Cancer 2022, 21, 51. [Google Scholar] [CrossRef]
- Xiong, X.; Liu, X.; Zhou, L.; Yang, J.; Yang, B.; Ma, H.; Xie, X.; Huang, Y.; Fang, S.; Xiao, S.; et al. Genome-wide association analysis reveals genetic loci and candidate genes for meat quality traits in Chinese Laiwu pigs. Mamm. Genome Off. J. Int. Mamm. Genome Soc. 2015, 26, 181–190. [Google Scholar] [CrossRef]
- Gawronska-Kozak, B.; Walendzik, K.; Machcinska, S.; Padzik, A.; Kopcewicz, M.; Wiśniewska, J. Dermal white adipose tissue (dWAT) is regulated by Foxn1 and Hif-1α during the early phase of skin wound healing. Int. J. Mol. Sci. 2021, 23, 257. [Google Scholar] [CrossRef] [PubMed]
- Kakudo, N.; Morimoto, N.; Ogawa, T.; Taketani, S.; Kusumoto, K. Hypoxia enhances proliferation of human adipose-derived stem cells via HIF-1α activation. PLoS ONE 2015, 10, e0139890. [Google Scholar] [CrossRef] [Green Version]
- Xiao, S.; Zhang, D.; Liu, Z.; Jin, W.; Huang, G.; Wei, Z.; Wang, D.; Deng, C. Diabetes-induced glucolipotoxicity impairs wound healing ability of adipose-derived stem cells-through the miR-1248/CITED2/HIF-1α pathway. Aging 2020, 12, 6947–6965. [Google Scholar] [CrossRef] [PubMed]
- Hootman, K.C.; Trezzi, J.P.; Kraemer, L.; Burwell, L.S.; Dong, X.; Guertin, K.A.; Jaeger, C.; Stover, P.J.; Hiller, K.; Cassano, P.A. Erythritol is a pentose-phosphate pathway metabolite and associated with adiposity gain in young adults. Proc. Natl. Acad. Sci. USA 2017, 114, E4233–E4240. [Google Scholar] [CrossRef] [PubMed]
- Stucchi, P.; Gil-Ortega, M.; Merino, B.; Guzmán-Ruiz, R.; Cano, V.; Valladolid-Acebes, I.; Somoza, B.; Le Gonidec, S.; Argente, J.; Valet, P.; et al. Circadian feeding drive of metabolic activity in adipose tissue and not hyperphagia triggers overweight in mice: Is there a role of the pentose-phosphate pathway? Endocrinology 2012, 153, 690–699. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Su, Y.F.; Yang, S.H.; Lee, Y.H.; Wu, B.C.; Huang, S.C.; Liu, C.M.; Chen, S.L.; Pan, Y.F.; Chou, S.S.; Chou, M.Y.; et al. Aspirin-induced inhibition of adipogenesis was p53-dependent and associated with inactivation of pentose phosphate pathway. Eur. J. Pharmacol. 2014, 738, 101–110. [Google Scholar] [CrossRef]
- Mili, N.; Paschou, S.A.; Goulis, D.G.; Dimopoulos, M.A.; Lambrinoudaki, I.; Psaltopoulou, T. Obesity, metabolic syndrome, and cancer: Pathophysiological and therapeutic associations. Endocrine 2021, 74, 478–497. [Google Scholar] [CrossRef]
- Avgerinos, K.I.; Spyrou, N.; Mantzoros, C.S.; Dalamaga, M. Obesity and cancer risk: Emerging biological mechanisms and perspectives. Metabolism 2019, 92, 121–135. [Google Scholar] [CrossRef]
- Zoico, E.; Darra, E.; Rizzatti, V.; Tebon, M.; Franceschetti, G.; Mazzali, G.; Rossi, A.P.; Fantin, F.; Zamboni, M. Role of adipose tissue in melanoma cancer microenvironment and progression. Int. J. Obes. 2018, 42, 344–352. [Google Scholar] [CrossRef]
- Niedermaier, T.; Behrens, G.; Schmid, D.; Schlecht, I.; Fischer, B.; Leitzmann, M.F. Body mass index, physical activity, and risk of adult meningioma and glioma: A meta-analysis. Neurology 2015, 85, 1342–1350. [Google Scholar] [CrossRef]
- Deng, L.; Li, W.; Liu, W.; Liu, Y.; Xie, B.; Groenen, M.A.M.; Madsen, O.; Yang, X.; Tang, Z. Integrative metabolomic and transcriptomic analysis reveals difference in glucose and lipid metabolism in the longissimus muscle of Luchuan and Duroc pigs. Front. Genet. 2023, 14, 1128033. [Google Scholar] [CrossRef] [PubMed]
- Mao, Y.; Ma, J.; Xia, Y.; Xie, X. The overexpression of epidermal frowth factor (EGF) in HaCaT cells promotes the proliferation, migration, invasion and transdifferentiation to epidermal stem cell immunophenotyping of adipose-derived stem cells (ADSCs). Int. J. Stem Cells 2020, 13, 93–103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hebert, T.L.; Wu, X.; Yu, G.; Goh, B.C.; Halvorsen, Y.D.; Wang, Z.; Moro, C.; Gimble, J.M. Culture effects of epidermal growth factor (EGF) and basic fibroblast growth factor (bFGF) on cryopreserved human adipose-derived stromal/stem cell proliferation and adipogenesis. J. Tissue Eng. Regen. Med. 2009, 3, 553–561. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xing, K.; Liu, H.; Zhang, F.; Liu, Y.; Shi, Y.; Ding, X.; Wang, C. Identification of key genes affecting porcine fat deposition based on co-expression network analysis of weighted genes. J. Anim. Sci. Biotechnol. 2021, 12, 100. [Google Scholar] [CrossRef] [PubMed]
circRNA_ID | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) |
---|---|---|
circZNF609 | GACAGTGGGGATGAATGGGA | TGTTCTCAGACCTGCCACAT |
circTEX9 | AAAGTGCCATGGAAGTTCGC | TTCCTCCAGTTGCCCTTCAA |
circCTIF | TGATTCCTTCAGTGGTGCCA | GCTGGGCAAATCTTCAAGGT |
circKIAA0556 | CTGAACACACATGGATGCCC | ATCCTTGGCCTTGACACTCA |
circPFKM | GGTAAGATCACAGCGGAGGA | GTTCCCGAAAGTCCTTGCAC |
circPATJ | CCTATTGGGCCCTGTATGAAG | AGTTTCTGTTTCCACTGCTCC |
circKIAA0513 | CTCATTGGCAAAGAGACCGG | TTCTCAGCCACACTAAGGGA |
circEGF | TTCCCGTGTTCTCTTAAGCG | CATCTGCCACCAATTGCTCA |
circSETBP1 | GGAGGAGGAAAGAGCCACT | TTCTCAGGAGGGTAAGGGA |
circCAMLG | CTTGCCTTTGGAGTCAGAGC | CCGAATCACCCAGCACTACT |
circRNASEH1 | GGAGGTGGTCAACAAAGAGG | CGTGTAGAGAACAGCTTGC |
circGUCY2C | TCTGGTGGAGGAAAGGACAC | TTTTGGTCATGGAAGAGGCC |
circRNA ID | Index | Score |
---|---|---|
circZNF609 | non-IRES | 0.342887 |
circTEX9 | IRES | 0.561539 |
circSETBP1 | IRES | 0.522931 |
circCTIF | IRES | 0.560397 |
circCAMLG | IRES | 0.660322 |
circRNASEH1 | non-IRES | 0.190536 |
circKIAA0556 | IRES | 0.529494 |
circGUCY2C | IRES | 0.594912 |
circPFKM | non-IRES | 0.141979 |
circPATJ | IRES | 0.582689 |
circKIAA0513 | non-IRES | 0.264454 |
circEGF | IRES | 0.804553 |
circRNA_ID | Minimal ORF Length (nt) | ||||
---|---|---|---|---|---|
30 | 75 | 150 | 300 | 600 | |
circZNF609 | 5 | 2 | 1 | 0 | 0 |
circTEX9 | 8 | 4 | 1 | 0 | 0 |
circCTIF | 5 | 3 | 3 | 0 | 0 |
circKIAA0556 | 5 | 4 | 1 | 1 | 1 |
circPFKM | 3 | 2 | 0 | 0 | 0 |
circPATJ | 3 | 1 | 0 | 0 | 0 |
circKIAA0513 | 4 | 3 | 0 | 0 | 0 |
circEGF | 5 | 2 | 1 | 1 | 0 |
circSETBP1 | 3 | 3 | 1 | 1 | 0 |
circCAMLG | 4 | 3 | 3 | 2 | 1 |
circRNASEH1 | 2 | 2 | 2 | 1 | 0 |
circGUCY2C | 2 | 1 | 1 | 0 | 0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
|
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qi, K.; Dou, Y.; Zhang, Z.; Wei, Y.; Song, C.; Qiao, R.; Li, X.; Yang, F.; Wang, K.; Li, X.; et al. Expression Profile and Regulatory Properties of m6A-Modified circRNAs in the Longissimus Dorsi of Queshan Black and Large White Pigs. Animals 2023, 13, 2190. https://doi.org/10.3390/ani13132190
Qi K, Dou Y, Zhang Z, Wei Y, Song C, Qiao R, Li X, Yang F, Wang K, Li X, et al. Expression Profile and Regulatory Properties of m6A-Modified circRNAs in the Longissimus Dorsi of Queshan Black and Large White Pigs. Animals. 2023; 13(13):2190. https://doi.org/10.3390/ani13132190
Chicago/Turabian StyleQi, Kunlong, Yaqing Dou, Zhe Zhang, Yilin Wei, Chenglei Song, Ruimin Qiao, Xiuling Li, Feng Yang, Kejun Wang, Xinjian Li, and et al. 2023. "Expression Profile and Regulatory Properties of m6A-Modified circRNAs in the Longissimus Dorsi of Queshan Black and Large White Pigs" Animals 13, no. 13: 2190. https://doi.org/10.3390/ani13132190