Changes in the Neurochemical Coding of the Anterior Pelvic Ganglion Neurons Supplying the Male Pig Urinary Bladder Trigone after One-Sided Axotomy of Their Nerve Fibers
Abstract
:1. Introduction
2. Results
2.1. Distribution and Number of FB+ Neurons in the APG Ganglia Supplying the UBT
2.2. Immunohistochemical Characteristic of FB+ Neurons Projecting to the UBT
2.2.1. Control Group
2.2.2. Experimental Group
2.3. Distribution and Immunohistochemical Characteristics of Intraganglionic Nerve Fibers
2.3.1. Control Group
2.3.2. Experimental Group
2.4. Expression of Genes Coding for the Synthesis of Selected Biologically Active Substances in the Right and Left APG
3. Discussion
4. Materials and Methods
4.1. Experimental Animals
4.2. Surgical Procedures and Injection of a Neural Retrograde Tracer
4.3. Animals Intended for Morphological Research
4.4. Animals Intended for Molecular Research
4.5. Collection, Fixation and Preparation of Tissues for Analysis
4.6. Molecular Research
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kaleczyc, J.; Wasowicz, K.; Klimczuk, M.; Czaja, K.; Łakomy, M. Immunohistochemical Characterisation and Cholinergic Neurons in the Anterior Pelvic Ganglion of the Male Pig. Folia Histochem. Cytobiol. 2003, 41, 65–72. [Google Scholar]
- Keast, J.R. Plasticity of Pelvic Autonomic Ganglia and Urogenital Innervation. Int. Rev. Cytol. 2006, 248, 141–208. [Google Scholar] [PubMed]
- Keast, J.R. Unusual Autonomic Ganglia: Connections, Chemistry, and Plasticity of Pelvic Ganglia. Int. Rev. Cytol. 1999, 193, 1–69. [Google Scholar] [PubMed]
- Pidsudko, Z. Immunohistochemical Characteristics and Distribution of Neurons in the Paravertebral, Prevertebral and Pelvic Ganglia Supplying the Urinary Bladder in the Male Pig. J. Mol. Neurosci. 2014, 52, 56–70. [Google Scholar] [CrossRef] [PubMed]
- Mitchell, B.S. Morphology and Neurochemistry of the Pelvic, and Paracervical Ganglia. Histol. Histopathol. 1993, 8, 761–773. [Google Scholar]
- Maggi, C. Nervous Control of the Urogenital System: Autonomic Nervous System; Harwood Academic Publishers, Ed.; Taylor & Francis: Chur, Switzerland, 1993. [Google Scholar]
- Lundborg, G. A 25-Year Perspective of Peripheral Nerve Surgery: Evolving Neuroscientific Concepts and Clinical Significance. J. Hand Surg. Am. 2000, 25, 391–414. [Google Scholar] [CrossRef] [PubMed]
- Hendry, I.A. The Response of Adrenergic Neurones to Axotomy and Nerve Growth Factor. Brain Res. 1975, 94, 87–97. [Google Scholar] [CrossRef]
- Hyatt-Sachs, H.; Bachoo, M.; Schreiber, R.; Vaccariello, S.A.; Zigmond, R.E. Chemical Sympathectomy and Postganglionic Nerve Transection Produce Similar Increases in Galanin and VIP MRNA but Differ in Their Effects on Peptide Content. J. Neurobiol. 1996, 30, 543–555. [Google Scholar] [CrossRef]
- Weyne, E.; Gevaert, T.; De Ridder, D.; Bivalacqua, T.J.; Van Der, A.F.; Albersen, M. 495 The Neuroregenerative Peptide Galanin Is Located in Human NNOS-Positive Pelvic Ganglia and Cavernous Nerves: A Novel Target for Post-Prostatectomy Nerve Regeneration? Eur. Urol. Suppl. 2014, 13, e495. [Google Scholar] [CrossRef]
- Wojtkiewicz, J.; Równiak, M.; Crayton, R.; Gonkowski, S.; Robak, A.; Zalecki, M.; Majewski, M.; Klimaschewski, L. Axotomy-Induced Changes in the Chemical Coding Pattern of Colon Projecting Calbindin-Positive Neurons in the Inferior Mesenteric Ganglia of the Pig. J. Mol. Neurosci. 2013, 51, 99–108. [Google Scholar] [CrossRef] [Green Version]
- Hyatt-Sachs, H.; Schreiber, R.C.; Bennett, T.A.; Zigmond, R.E. Phenotypic Plasticity in Adult Sympathetic Ganglia in Viva: Effects of Deafferentation and Axotomy on the Expression of Vasoactive Intestinal Peptide. J. Neurosci. 1993, 13, 1642–1653. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Klimaschewski, L.; Tran, T.D.; Nobiling, R.; Heym, C. Plasticity of Postganglionic Sympathetic Neurons in the Rat Superior Cervical Ganglion after Axotomy. Microsc. Res. Tech. 1994, 29, 120–130. [Google Scholar] [CrossRef]
- Mohney, R.P.; Siegel, R.E.; Zigmond, R.E. Galanin and Vasoactive Intestinal Peptide Messenger RNAs Increase Following Axotomy of Adult Sympathetic Neurons. J. Neurobiol. 1994, 25, 108–118. [Google Scholar] [CrossRef] [PubMed]
- Schreiber, R.C.; Hyatt-Sachs, H.; Bennett, T.A.; Zigmond, R.E. Galanin Expression Increases in Adult Rat Sympathetic Neurons after Axotomy. Neuroscience 1994, 60, 17–27. [Google Scholar] [CrossRef]
- Skobowiat, C.; Calka, J.; Majewski, M. Axotomy Induced Changes in Neuronal Plasticity of Sympathetic Chain Ganglia (SChG) Neurons Supplying Descending Colon in the Pig. Exp. Mol. Pathol. 2011, 90, 13–18. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Zigmond, R.E. Involvement of Leukemia Inhibitory Factor in the Increases in Galanin and Vasoactive Intestinal Peptide MRNA and the Decreases in Neuropeptide Y and Tyrosine Hydroxylase MRNA in Sympathetic Neurons After Axotomy. J. Neurochem. 2002, 67, 1751–1760. [Google Scholar] [CrossRef] [PubMed]
- Wasowicz, W. Effect of Total or Partial Uterus Extirpation on Sympathetic Uterus-Projecting Neurons in Porcine Inferior Mesenteric Ganglion. B. Changes in Expression of Neuropeptide Y, Galanin, Vasoactive Intestinal Polypeptide, Pituitary Adenylate-Cyclase Activating. Pol. J. Vet. Sci. 2003, 6, 147–160. [Google Scholar]
- Wasowicz, W. Effect of Total or Partial Uterus Extripation on Uterus- Projecting Neurons in Porcine Inferior Mesenteric Ganglion. A. Changes in Expression of Transmitter-Synthesizing Enzymes-Tyrosine Hydroxylase, Dopamine Beta-Hydroxylase and Choline Acetyltransferas. Pol. J. Vet. Sci. 2003, 6, 131–145. [Google Scholar] [PubMed]
- Sienkiewicz, W. Immunohistochemical Properties of Caudal Mesenteric Ganglion and Anterior Pelvic Ganglion Neurons Projecting to the Porcine Testes Subjected to Hemi Castration, Castration and Testosterone Supplementation. Bull. Vet. Inst. Pulawy 2010, 54, 357–367. [Google Scholar]
- Kaleczyc, J.; Kasica-Jarosz, N.; Pidsudko, Z.; Dudek, A.; Klimczuk, M.; Sienkiewicz, W. Effect of Castration on Pelvic Neurons in the Male Pig. Histochem. Cell Biol. 2020, 153, 135–151. [Google Scholar] [CrossRef]
- Swindle, M.M.; Smith, A.C. Swine in Biomedical Research. In Source Book of Models for Biomedical Research; Humana Press: Totowa, NJ, USA, 2008; pp. 233–239. [Google Scholar]
- Swindle, M.M.; Makin, A.; Herron, A.J.; Clubb, F.J.; Frazier, K.S. Swine as Models in Biomedical Research and Toxicology Testing. Vet. Pathol. 2012, 49, 344–356. [Google Scholar] [CrossRef]
- Ragionieri, L.; Botti, M.; Gazza, F.; Sorteni, C.; Chiocchetti, R.; Clavenzani, P.; Minelli, L.B.; Panu, R. Localization of Peripheral Autonomic Neurons Innervating the Boar Urinary Bladder Trigone and Neurochemical Features of the Sympathetic Component. Eur. J. Histochem. 2013, 57, 93–105. [Google Scholar] [CrossRef] [PubMed]
- Lopachin, R.M.; Lehning, E.J. Mechanism of Calcium Entry during Axon Injury and Degeneration. Toxicol. Appl. Pharm. 1997, 143, 233–244. [Google Scholar] [CrossRef] [PubMed]
- Obál, I.; Engelhardt, J.I.; Siklós, L. Axotomy Induces Contrasting Changes in Calcium and Calcium-Binding Proteins in Oculomotor and Hypoglossal Nuclei of Balb/c Mice. J. Comp. Neurol. 2006, 499, 17–32. [Google Scholar] [CrossRef] [PubMed]
- Krebs, C.; Neiss, W.F.; Streppel, M.; Guntinas-lichius, O.; Dassesse, D.; Stennert, E.; Pochet, R. Axotomv Induces D28K Ikmunoreactivity in Hypo- Glossal Motoneurons in Vivo. Cell Calcium 1997, 22, 367–372. [Google Scholar] [CrossRef]
- Zigmond, R.E.; Sun, Y. Regulation of Neuropeptide Expression in Sympathetic Neurons. Paracrine and Retrograde Influences. Ann. N. Y. Acad. Sci. 1997, 814, 181–197. [Google Scholar] [CrossRef] [PubMed]
- Hendry, I.A.; Campbell, J. Morphometric Analysis of Rat Superior Cervical Ganglion after Axotomy and Nerve Growth Factor Treatment. J. Neurocytol. 1976, 5, 351–360. [Google Scholar] [CrossRef]
- Hill, C.E.; Hendry, I.A.; Ngu, M.C.; Van Helden, D.F. Subpopulations of Sympathetic Neurones Differ in Their Sensitivity to Nerve Growth Factor Antiserum. Dev. Brain Res. 1985, 23, 121–130. [Google Scholar] [CrossRef]
- Hendry, I.A.; Iversen, L.L. Effect of Nerve Growth Factor and Its Antiserum on Tyrosine Hydroxylase Activity in Mouse Superior Cervical Sympathetic Ganglion. Brain Res. 1971, 29, 159–162. [Google Scholar] [CrossRef]
- Viana, R.; Batourina, E.; Huang, H.; Dressler, G.R.; Kobayashi, A.; Behringer, R.R.; Shapiro, E.; Hensle, T.; Lambert, S.; Mendelsohn, C. The Development of the Bladder Trigone, the Center of the Anti-Reflux Mechanism. Development 2007, 134, 3763–3769. [Google Scholar] [CrossRef] [Green Version]
- Maeda, M.; Ohba, N.; Nakagomi, S.; Suzuki, Y.; Kiryu-Seo, S.; Namikawa, K.; Kondoh, W.; Tanaka, A.; Kiyama, H. Vesicular Acetylcholine Transporter Can Be a Morphological Marker for the Reinnervation to Muscle of Regenerating Motor Axons. Neurosci. Res. 2004, 48, 305–314. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Salvaterra, P.M.; Loera, S.; Chiu, A.Y. Brain-Derived Neurotrophic Factor Spares Choline Acetyltransferase MRNA Following Axotomy of Motor Neurons in Vivo. J. Neurosci. Res. 1997, 47, 134–143. [Google Scholar] [CrossRef]
- ZIGMOND, R.E. Neuropeptide Action in Sympathetic Ganglia: Evidence for Distinct Functions in Intact and Axotomized Ganglia. Ann. N. Y. Acad. Sci. 2006, 921, 103–108. [Google Scholar] [CrossRef]
- Zigmond, R.E. Plasticity in the Autonomic Nervous System. Responses of Adult Sympathetic Neurons to Injury. In Handbook of the Autonomic Nervous System in Health Disease; Scitech Book News: Portland, OR, USA, 2003; pp. 167–184. [Google Scholar]
- Sun, Y.; Zigmond, R.E. Leukaemia Inhibitory Factor Induced in the Sciatic Nerve after Axotomy Is Involved in the Induction of Galanin in Sensory Neurons. Eur. J. Neurosci. 1996, 8, 2213–2220. [Google Scholar] [CrossRef]
- Pidsudko, Z.; Kaleczyc, J.; Majewski, M.; Lakomy, M.; Scheuermann, D.W.; Timmermans, J.P. Differences in the Distribution and Chemical Coding between Neurons in the Inferior Mesenteric Ganglion Supplying the Colon and Rectum in the Pig. Cell Tissue Res. 2001, 303, 147–158. [Google Scholar] [CrossRef] [PubMed]
- Kasica-Jarosz, N.; Podlasz, P.; Kaleczyc, J. Pituitary Adenylate Cyclase-Activating Polypeptide (PACAP-38) Plays an Inhibitory Role against Inflammation Induced by Chemical Damage to Zebrafish Hair Cells. PLoS ONE 2018, 13, e0198180. [Google Scholar] [CrossRef] [PubMed]
Primary Antibodies | |||||
Antigen | Clonality | Host | Dilution | Company | Catalog No. |
Dopamine beta hydroxylase -DBH | polyclonal | rabbit | 1:200 | Enzo | BML-DZ1020-0050 |
Tyrosine hydroxylase -TH | monoclonal | mouse | 1:1000 | Sigma Aldrich | T2928 |
Vesicular acetylcholine transporter -VAChT | polyclonal | rabbit | 1:4000 | Sigma Aldrich | V5387 |
Choline acetyltransferase -ChAT | polyclonal | goat | 1:10000 | Merk Millipore | AB144P |
Galanin -GAL | polyclonal | rabbit | 1:2000 | Sigma | AB2233 |
Neuropeptide Y -NPY | monoclonal | rat | 1:400 | Enzo Life Sciences | BML-NA 1233 |
Nitric oxide synthase brain -bNOS | monoclonal | mouse | 1:200 | Sigma Aldrich | N2280 |
Vasoactive intestinal polypeptide | polyclonal | mouse | 1:500 | Biogenesis | 9535-0504 |
Secondary Antibodies | |||||
Antigen | Fluorophore | Host | Dilution | Company | Catalog No. |
Mouse IgG | Alexa 488 | goat | 1:1000 | Invitrogen | A-11001 |
Rat IgG | Alexa 488 | goat | 1:1000 | Invitrogen | A-11006 |
Rabbit IgG | Alexa 488 | goat | 1:1000 | Invitrogen | A-11008 |
Mouse IgG | Alexa 555 | goat | 1:1000 | Invitrogen | A-21127 |
Rabbit IgG | Alexa 555 | goat | 1:1000 | Life Technologies | A 21428 |
Goat IgG | Alexa 568 | donkey | 1:500 | Invitrogen | A-11057 |
Gene | Forward Sequence 5’-3’ | Reverse Sequence 5’-3’ | Accession Number |
---|---|---|---|
gapdh | GATCGTCAGCAATGCCTCCT | GATGCCGAAGTGGTCATGGA | NM_001206359.1 |
th | TGCACCCAGTAYATCCGCCAYGC | TAGYTCCTGAGCTTGTCCTT | NM_214131.1 |
dbh | AACTCGTTCAACCGCCAAGT | AGGTTCCACTCACCCTGGAA | XM_001927211.6 |
slc18a1 - VAChT | CAACCTCTTTGGCGTGTTGG | ATGAGCCAGAGGCACACAAA | XM_021072276.1 XM_021072275.1 XM_021072274.1 XM_013990243.2 |
chat | GCTAGCCTTCTACAGGCTCC | AGTGGCCGATCGAATGTTGT | NM_001102473.1 NM_001104955.1 |
gal | TGGGCCACATGCCATCGACA | CGGCCTGGCTTCGTCTTCGG | NM_214234.1 |
N nos | TTCGTGCGTCTCCACACCAA | AGTACTTGAAGGCCTGGAAGA | XM_003357447.5 XM_005667633.3 XM_003130163.6 XM_013979715.2 XM_003130164.6 |
vip | CTGACAACTACACCCGCCTT | TCTCCTTCAATGCTCCGCTT | NM_001195233.1 |
npy | TCACCAGGCAGAGATACGGA | ACACAGAAGGGTCTTCGAGC | NM_001256367.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
|
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Listowska, Ż.; Pidsudko, Z. Changes in the Neurochemical Coding of the Anterior Pelvic Ganglion Neurons Supplying the Male Pig Urinary Bladder Trigone after One-Sided Axotomy of Their Nerve Fibers. Int. J. Mol. Sci. 2021, 22, 2231. https://doi.org/10.3390/ijms22052231
Listowska Ż, Pidsudko Z. Changes in the Neurochemical Coding of the Anterior Pelvic Ganglion Neurons Supplying the Male Pig Urinary Bladder Trigone after One-Sided Axotomy of Their Nerve Fibers. International Journal of Molecular Sciences. 2021; 22(5):2231. https://doi.org/10.3390/ijms22052231
Chicago/Turabian StyleListowska, Żaneta, and Zenon Pidsudko. 2021. "Changes in the Neurochemical Coding of the Anterior Pelvic Ganglion Neurons Supplying the Male Pig Urinary Bladder Trigone after One-Sided Axotomy of Their Nerve Fibers" International Journal of Molecular Sciences 22, no. 5: 2231. https://doi.org/10.3390/ijms22052231