Modulation of Poliovirus Replicative Fitness in HeLa Cells by Deoptimization of Synonymous Codon Usage in the Capsid Region

The Sabin Original +2 (64) master seed of the Sabin type 2 OPV strain (P712 Ch 2ab) was kindly provided by R. Mauler of Behringwerke AG (Marburg, Germany). The virus was grown at 35°C in suspension cultures (63) of HeLa S3 cells (human cervical carcinoma cells; ATCC CCL-2.2) (11) or in monolayer cultures of HeLa (ATCC CCL-2) (11) or RD (human rhabdomyosarcoma cells; ATCC CCL-136) cells. Some initial plaque assays were performed with HEp-2C cells (11).

Poliovirus RNA was extracted from 250 μl of cell culture lysate (from ∼75,000 infected cells) by using TRIZOL LS reagent (Invitrogen, Carlsbad, Calif.) and further purified on Centri-Sep columns (Princeton Separations, Adelphia, N.J.). Full-length cDNA was prepared by reverse transcription (42°C for 2 h) of ∼1 μg of viral RNA in a 20-μl reaction mix containing a 500 μM concentration of each deoxynucleoside triphosphate (dNTP; Roche Applied Science, Indianapolis, Ind.), 200 U Superscript II reverse transcriptase (Invitrogen), 40 U RNase inhibitor (Roche), 10 mM dithiothreitol, and 500 ng primer S2-7439A-B [CCTAAGC(T)₃₀CCCCGAATTAAAGAAAAATTTACCCCTACA] (13) in Superscript II buffer. After reverse transcription, 2 U RNase H (Roche) was added and incubated at 37°C for 40 min. Long-PCR amplification of viral cDNA was performed using TaqPlus Precision (Stratagene, La Jolla, Calif.) and AmpliWax PCR Gem 100 beads (Applied Biosystems, Foster City, Calif.) for “hot start” PCR in thin-walled tubes. The bottom mix (50 μl) contained a 400 μM concentration of each dNTP (Roche) and 250 ng each of primers S2-7439A-B and S2-1S-C (GTAGTCGACTAATACGACTCACTATAGGTTAAAACAGCTCTGGGGTTG) in TaqPlus Precision buffer. A wax bead was added to each tube, and samples were heated at 75°C for 4 min and cooled to room temperature. The top mix (50 μl) contained 2 μl of cDNA and 10 U TaqPlus Precision in TaqPlus Precision buffer. The samples were incubated in a thermal cycler at 94°C for 1 min and then amplified by 30 PCR cycles (94°C for 30 s, 60°C for 30 s, and 72°C for 8 min), followed by a final denaturation step of 94°C for 1 min and a final extension step of 72°C for 20 min.

PCR products were purified using a QIAquick PCR purification kit (QIAGEN, Valencia, Calif.) and sequentially digested for 2 h at 37°C with the restriction enzymes SalI and HindIII prior to gel purification. PCR products were ligated into pUC19 plasmids following standard methods (65), and ligated plasmids were transformed into XL-10 Gold supercompetent E. coli cells (Stratagene) (65). Sequences of the inserts were determined by cycle sequencing using an automated DNA sequencer (Applied Biosystems) (43).

Full-length cDNA plasmids were linearized with HindIII and purified on QIAquick columns prior to RNA transcription from 1 μg of plasmid DNA using a Megascript T7 in vitro transcription kit (Ambion, Austin, Tex.). RNA yields were estimated by using DNA Dipsticks (Invitrogen), and RNA chain lengths were analyzed by electrophoresis on 1% agarose-2.2 M formaldehyde gels (40) prior to transfection. RD cells were transfected with transcripts of viral RNA by using Tfx-20 reagent (Promega, Madison, Wis.). Briefly, semiconfluent RD cells in 12-well cell culture plates were inoculated with 500 μl minimum essential medium (incomplete MEM) (GIBCO, Carlsbad, Calif.) containing 0.1 μg viral RNA transcript and 0.45 μl Tfx-20 reagent. Plates were incubated for 1 h at 35°C prior to the addition of 1.5 ml complete MEM (incomplete MEM supplemented with 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM l-glutamine, 0.075% NaHCO₃, and 10 mM HEPES [pH 7.5]) (GIBCO) containing 3% fetal bovine serum (FBS; HyClone, Logan, Utah). Negative controls were performed using RNA transcribed from pBluescript II SK(+) (Stratagene) containing a cDNA insert of the incomplete viral genome (truncated at base 7200 by digestion with BamHI) in reverse orientation from a T3 promoter. A complete cytopathic effect (CPE) was observed for most viruses after incubation at 35°C for 18 to 20 h, at which time 400 μl from each transfected well was transferred to a confluent RD cell monolayer in a 75-cm² flask containing complete MEM. In this second passage, complete CPE was observed after 24 h at 35°C for all but the most highly modified viruses (e.g., S2R23), which were incubated for an additional 24 to 48 h. Viruses were liberated from the infected cells by three freeze-thaw cycles and clarification by centrifugation (15,000 × g, 15 min). The sequences of all virus stocks were verified by in vitro amplification of two large overlapping fragments and sequence analysis of the PCR products.

Single base substitutions were introduced by using a QuikChange site-directed mutagenesis kit (Stratagene). Briefly, two complementary primers containing the desired mutation were designed for PCR amplification of the plasmid containing the Sabin 2 cDNA insert. Amplification was performed using Pfu Turbo DNA polymerase on 5 ng of template DNA for 15 cycles at 95°C for 30 s, 50°C for 1 min, and 68°C for 15 min. PCR products were digested for 1 h at 37°C with 10 U of DpnI prior to transformation into XL-1 Blue supercompetent E. coli cells. Colonies were grown and screened by sequencing as described above.

Multiple base substitutions were introduced by assembly PCR (68). Primers were designed to span the region of interest, with complementary 40-mers overlapping by 10 nucleotides (nt) on each end. A first round of assembly (30 PCR cycles of 94°C for 45 s, 52°C for 45 s, and 72°C for 45 s) was performed with a 20-μl reaction mixture containing TaqPlus Precision buffer, 10 U TaqPlus Precision, 5 pmol of each primer, and a 200 μM concentration of each dNTP. A second round of assembly (25 PCR cycles of 94°C for 45 s, 50°C for 45 s, and 72°C for 2 min) was performed, using the outermost sense and antisense primers in a 100-μl reaction mixture containing TaqPlus Precision buffer, 2 μl of product from the first assembly round, 10 U TaqPlus Precision, 15 pmol of each primer, and a 400 μM concentration of each dNTP. PCR products were purified on QIAquick PCR columns prior to digestion, ligation, and transformation into XL-10 Gold supercompetent cells. Clones were grown and screened by sequencing of the insert as described above.

The sequence of our full-length Sabin 2 infectious cDNA construct, S2R9, differed from the published sequence of a reference Sabin 2 strain (59) at three synonymous third codon positions, i.e., G₂₆₁₆ (in the VP1 region; A was replaced to introduce an EagI restriction site), T₃₃₀₃ (in the VP1 region; A was replaced to introduce an XhoI site), and A₅₆₄₀ (in the 3C^pro region). The virus derived from the S2R9 construct was used as our reference Sabin 2 strain. Recombinant cDNAs having different combinations of blocks of replacement codons were constructed using standard methods (37).

Plaque assays were performed by a modification of previously described methods (78). Briefly, confluent HeLa (or HEp-2C) cell monolayers in 57-cm² cell culture dishes were washed, inoculated with virus in incomplete MEM, and incubated at room temperature for 30 min prior to the addition of 0.45% SeaKem LE agarose (BioWhittaker Molecular, Rockland, Maine) in complete MEM containing 2% fetal bovine serum (FBS). Plates were incubated for 60 h at 35°C, fixed with 0.4% formaldehyde, and stained with 3% crystal violet. Plaque sizes were quantified from digital images of the plates made with a FOTO/Analyst archiver system (Fotodyne, Hartland, Wis.) and by subsequent image analysis using Scion Image for Windows (Scion Corp., Frederick, Md.).

Virus infectivities were also measured by the limiting dilution method, using HeLa (or RD) cell monolayers cultured in 96-well plates. Plates were monitored for CPE for up to 7 days, and 50% cell culture infectious dose (CCID₅₀) titers were calculated by the method of Kärber (32).

HeLa S3 suspension cells (1 × 10⁷ cells in 2.5 ml) were infected at a multiplicity of infection (MOI) of 5 PFU/cell, with stirring, for 30 min at 25°C. Cells were then sedimented by low-speed centrifugation and resuspended in 2.5 ml warm complete medium (MEM lacking calcium salts) containing glutamine, 5% FBS, penicillin-streptomycin, and 25 mM HEPES (pH 7.5). Incubation was continued at 35°C in a water bath, with orbital shaking at 300 rpm. Samples were withdrawn at 2-h intervals from 0 to 14 h postinfection and titrated by plaque assay at 35°C.

Confluent HeLa cell monolayers (∼1.6 × 10⁶ cells per 9.5-cm² well; six-well plates) were infected with virus derived from the S2R9, S2R19, or S2R23 cDNA construct at an MOI of 25 PFU/cell and incubated at 35°C for 4 h in a 5% CO₂ incubator in 2.0 ml complete MEM with 2% FBS. The medium was replaced with 1.9 ml of labeling medium (200 μCi [³⁵S]methionine in a 1:7 mixture of complete MEM and MEM without methionine, supplemented with 2% FCS). Cultures were incubated in a CO₂ incubator at 35°C for 3 h. The radioactive medium was removed, and cells were rinsed twice with phosphate-buffered saline. Cells were lysed in 1 ml lysis buffer (1% NP-40 in 10 mM NaCl, 10 mM Tris-Cl [pH 7.5], and 1.5 mM MgCl₂) at 35°C for 1 min (6). Lysates were transferred to microcentrifuge tubes on ice and centrifuged at 2,000 × g for 2 min at 4°C, and the supernatants were transferred to new tubes. Sodium dodecyl sulfate (SDS) was added to the supernatants to a final concentration of 1%, and samples were frozen. Labeled viral proteins were separated by SDS-10% polyacrylamide gel electrophoresis (SDS-10% PAGE) (38). Gels were fixed, washed, dried, and exposed to Kodak BioMax film for 1 to 3 days at room temperature.

Viral RNAs transcribed from recombinant plasmids were translated in vitro in nuclease-treated rabbit reticulocyte lysates (Promega) supplemented with uninfected HeLa cell extracts as previously described (6, 7, 80). Briefly, 35 μl micrococcal nuclease-treated, supplemented rabbit reticulocyte lysate was mixed with 7 μl HeLa cell extract, 1 μl 1 mM amino acid mix (without methionine), various amounts of RNA (0.2 μg to 1 μg), 30 μCi [³⁵S]methionine (1,200 Ci/mmol), and 40 U Protector RNase inhibitor (Roche) in a final volume of 50 μl. The reaction mixtures were incubated at 30°C for 3 h. Samples were analyzed by SDS-10% PAGE as described above.

Viruses were propagated in RD cells, liberated by freeze-thawing, and concentrated by precipitation with polyethylene glycol 6000 (52). Virions were purified by pelleting, isopycnic centrifugation in CsCl, and repelleting, essentially as described previously (52). The number of virus particles in each preparation recovered from the CsCl band with a buoyant density of 1.34 g/ml was calculated from the absorbance at 260 nm, using the relationship of 9.4 × 10¹² virions per optical density unit at 260 nm (62).

The production of viral RNAs in infected HeLa cells during the single-step growth experiments described above was measured by quantitative reverse transcription-PCR using a Stratagene MX4000 PCR system programmed to incubate reaction mixtures at 48°C for 30 min and 95°C for 10 min, followed by 60 PCR cycles (95°C for 15 s, 60°C for 1 min). Sequences within the 3′ half of the 3D^pol region of Sabin 2 were amplified using primers S2/7284A (ATTGGCACACTCCTGATTTTAGC) and S2/7195S (CAAAGGATCCCAGAAACACACA), and the amplicon yield was measured by the fluorescence at 517 nm of the TaqMan probe S2/7246AB (TTCTTCTTCGCCGTTGTGCCAGG), with 6-carboxyfluorescein attached to the 5′ end and BHQ-1 (Biosearch Technologies, Novato, Calif.) attached to the 3′ end. Stoichiometric calculations used a value of 2.4 × 10⁶ for the molecular weight of Sabin 2 RNA (36, 70).

Transcripts (0.1 μg) from constructs S2R9, S2R19, and S2R23 were transfected onto monolayers of 2.5 × 10⁵ HeLa cells as described above for RD cells. After 12 h of incubation at 35°C, viruses were liberated by three freeze-thaw cycles, and the clarified supernatants were assayed for infectivity by the limiting dilution method on HeLa cell monolayers as described above.

Poliovirus constructs S2R9, S2R19, and S2R23 were passaged 25 times in HeLa cell monolayers in T75 flasks incubated at 35°C for 36 h, with input MOIs ranging from 0.1 to 0.4 PFU/cell (measured on HeLa cells). Every fifth passage, virus plaque areas, plaque yields, and the genomic sequences of the bulk virus populations were determined, and the MOI was readjusted to ∼0.1 PFU/cell.

Predictions of the secondary structures of the RNA templates of virus constructs S2R9, S2R19, and S2R23 were performed using the mfold v. 3.1 program (47, 54, 82), which implements an energy minimization algorithm that finds a structure with the calculated minimum free energy (MinE). The MinE structure is plotted and color annotated with P-num values, which provide a measure of the number of alternative pairings for each nucleotide base (82). The running parameters were set to default values, except for the folding temperature (T), which was set to 35°C. Structures with suboptimal thermodynamic stabilities having increased free energy increments (ΔΔG_35°C) of 4 kcal/mol, 8 kcal/mol, and 12 kcal/mol were analyzed by using color-annotated energy dot plots (82).

Complete genomic sequences of the poliovirus constructs S2R9, S2R19, and S2R23 were submitted to the GenBank library under accession numbers DQ205099, DQ205098, and DQ205100, respectively.

Mononucleotide and dinucleotide frequencies and codon usage were analyzed in the original reports of poliovirus genomic sequences (36, 57, 61, 70). The mono-, di-, and trinucleotide frequency patterns are similar for the three Sabin strains (70) and appear to be conserved across poliovirus genotypes (24, 35, 39, 42, 46, 78) and other human enterovirus species C serotypes (8). As with other enteroviruses, the component bases in the Sabin 2 open reading frame (ORF) are present in approximately equal proportions (24.0% U, 22.9% C, 29.9% A, and 23.1% G) (59, 70), a property favorable to a low bias in codon usage (53). All codons are used in poliovirus ORFs (70), and the overall degree of codon usage bias is indeed low (29). One measure of codon usage bias is the effective number of codons used in a genetic interval (N_C), which can vary from 20 (only one codon used for each amino acid) to 61 (all codons used randomly) (74). The N_C values for Sabin 2 are 56.0 for the capsid region and 54.6 for the complete ORF. As with the genomes of vertebrates (34) and nearly all RNA viruses (33), the dinucleotide CG is suppressed in the Sabin 2 genome (70), and the observed pattern of codon usage reflects this suppression (Table 1).

Despite the low overall bias in codon usage in Sabin 2, some synonymous codons are used at much lower frequencies than others (Table 1). To examine the biological effects of altered codon usage, we replaced the original codons of Sabin 2 with synonymous nonpreferred codons (Table 1). The codon replacements were introduced only within the P1/capsid region sequences because those sequences uniquely identify poliovirus serotypes (8, 20, 42, 78), as P2/noncapsid region, P3/noncapsid region, 3′-untranslated region (3′-UTR), and 5′-UTR sequences are exchanged out by recombination with other species C enteroviruses during poliovirus circulation (8, 20, 35, 42, 78). Because the usage bias was very low for most twofold degenerate codons (except codons for His and Tyr), we replaced only sixfold, fourfold, and threefold degenerate codons. Synonymous codons for nine amino acids were replaced by single nonpreferred codons, as follows: CUU for Leu, AGC for Ser, CGG for Arg, CCG for Pro, GUC for Val, ACG for Thr, GCG for Ala, GGU for Gly, and AUC for Ile (Table 1). Whenever possible, we chose codons with G or C at degenerate positions in order to increase the G+C contents of the modified viral genomes.

Replacement codons were introduced into a full-length infectious cDNA clone derived from Sabin 2 (construct S2R9) within an interval (nt 748 to 3302) spanning all but the last 27 codons of the capsid region (Fig. 1). The capsid interval was divided into the following four mutagenesis cassettes: A (nt 657 to 1317; 661 bp), B (nt 1318 to 2102; 785 bp), C (nt 2103 to 2615; 513 bp), and D (nt 2616 to 3302; 687 bp) (Fig. 1). Mutagenesis cassette A, bounded by restriction sites BstZ17I and AvrII, includes the last 91 nucleotides of the 5′ UTR, but no 5′-UTR sequences were modified in cassette A. Within each cassette, synonymous codons for the nine amino acids were comprehensively replaced, except at 15 positions (replacement at 11 of these positions would have eliminated desirable restriction sites or generated undesirable restriction sites). Unmodified cassettes are identified by capital italic letters; the corresponding cassettes with replacement codons are identified by lowercase italic letters. Thus, the reference Sabin 2 derivative (derived from cDNA construct S2R9) is identified as ABCD, and the fully modified virus (derived from cDNA construct S2R23) is identified as abcd (Fig. 2).

The modifications dramatically altered the mono-, di-, and trinucleotide (codon) frequencies in the capsid region (Tables 1 and 2). In the fully modified virus, abcd, nearly half (425/879; 48.4%) of the ABCD capsid region codons were replaced, and a total of 542 substitutions (90 at the first codon position, 44 at the second position, and 408 at the third position) were introduced into the 2,555 nucleotides of the codon replacement capsid region interval (Table 1). Compared with ABCD, the N_C value for the capsid region of abcd fell from 56.2 to 29.8, the number of CG dinucleotides rose from 97 to 302, and the %G+C increased from 48.4% to 56.4% (Table 2). These changes were nearly uniformly distributed over the codon replacement capsid region interval (Fig. 1; Table 2).

RNA transcripts of cDNA constructs with various combinations of codon replacement cassettes (Fig. 2) were transfected into RD cells. The viruses obtained from the primary transfections were passaged again in RD cells to increase virus titers. The growth properties of the viruses were then measured in HeLa cells by plaque assays (Fig. 3) and single-step growth experiments (Fig. 4).

An approximately linear inverse relationship was observed between the mean plaque area in HeLa cells and the number of nucleotide changes introduced into the capsid region (Fig. 3A and C). Similar inverse linear relationships were observed when the abscissa was rescaled to the number of replacement codons or to the number of CG dinucleotides (data not shown). There was no strong polarity for the effects of codon replacement within the capsid region, as the introduction of replacement codons into any combination of the four cassettes reduced plaque areas approximately in proportion to the total number of replacement codons. However, replacements of codons in the VP1 region (cassette D) appeared to have stronger effects than replacements elsewhere (Fig. 3). Codon replacement in three or four cassettes generally conferred a minute plaque phenotype (mean plaque area of <25% that of the unmutagenized ABCD prototype), and the mean areas of the observed plaques of the abcd virus were ∼9% those of the ABCD prototype (Fig. 3). An exception was virus abcD, which had a greater mean plaque area (∼38% that of ABCD) than Abcd, aBcd, and abCd, underscoring the stronger influence on plaque size of codon replacement within the VP1 region.

Measurements of plaque areas and total plaque numbers became increasingly difficult as plaque sizes decreased. The diameters of poliovirus plaques are typically heterogeneous, and this heterogeneity was observed with the plaques of all virus constructs. Precise measurement was most difficult with the smallest of the minute plaques, as was discriminating very minute plaques from other small defects in the cell monolayers. Extended incubation of plaque cultures to 72 h increased plaque diameters but did not increase the plaque counts. Plaque morphologies were similar when the plaque assays were performed on HEp-2C cells, but the titers were ∼2.5-fold lower than the HeLa plaque titers for all virus constructs.

A plaque is the result of several cycles of replication, such that any differences in replication rates are amplified. To examine the relationships between plaque size, virus growth rate, and virus yield, single-step growth experiments (input MOI, 5 PFU/cell) were performed with HeLa cells at 35°C, and virus titers were determined by plaque assay on HEp-2C cells (35°C), which generally had more uniform monolayers, facilitating the enumeration of minute plaques. Mean virus yields from the single-step growth experiments generally decreased as the number of replacement codons increased (Fig. 3B and 4). Mean virus yields were highest (5.2 × 10⁸ PFU/ml [equivalent to ∼130 PFU/cell] for HEp-2C cells) for the ABCD prototype and viruses ABcD and aBCD. Yields were 4- to 8-fold lower with ABCd, abCD, and ABcd, 12- to 24-fold lower with abcD and aBcd, 30- to 45-fold lower with Abcd and abCd, and ∼65-fold lower (8.3 × 10⁶ PFU/ml; ∼2 PFU/cell) with abcd (Fig. 3B and 4). Moreover, the production of infectious virus appeared to be slower in the codon replacement viruses than in the unmodified ABCD prototype. Although maximum plaque yields were obtained at 10 to 12 h for all viruses, the proportions of the final yields detected at 4 h were lower for the codon replacement viruses (Fig. 4).

Our working hypothesis was that the replacement of preferred codons with nonpreferred codons might lower replicative fitness primarily by reducing the rate of translation (at the level of polypeptide chain elongation) of viral proteins and potentially disrupting their proteolytic processing in infected cells. To test this hypothesis, we labeled HeLa cells infected with Sabin 2, ABCD (unmodified prototype), ABCd (modified VP1 region), or abcd (modified capsid region) with [³⁵S]methionine from 4 to 7 h postinfection and resolved the labeled viral proteins by SDS-PAGE. Unexpectedly, the electrophoretic profiles of the labeled virus-specific proteins were similar for all four viruses, both in the relative intensities of the labeled viral protein bands and in the total amounts of labeled viral proteins produced in the infected cells (Fig. 5A). The four viruses were similar in the efficiency of shutoff of host cell protein synthesis and in the synthesis and processing of viral proteins in infected HeLa cells.

The observation that codon replacement had little detectable effect in vivo on viral protein synthesis and processing was mirrored by the results of in vitro translation experiments with rabbit reticulocyte lysates. Full-length in vitro transcripts from cDNA constructs ABCD, ABCd, and abcd programmed the in vitro synthesis and processing of virus-specific proteins with nearly equal efficiencies (Fig. 5B). Taking the results of the in vivo and in vitro protein synthesis experiments together, we found no evidence to support our initial hypothesis that the reduced replicative fitness of the codon replacement viruses was primarily attributable to an impairment of translation and processing of viral proteins.

We analyzed the poliovirions produced by HeLa cells infected with viruses ABCD, ABCd, and abcd. Purified infectious virions of all three viruses had similar electrophoretic profiles and the high VP2/VP0 ratios typical of mature capsids (data not shown). However, the specific infectivities of the purified virions decreased with increased numbers of replacement codons. For example, the particle/PFU ratio increased from 293 (ABCD) to 1,221 (ABCd) or 5,392 (abcd). The magnitude of the decline in specific infectivity was dependent on the choice of infectivity assay and was steeper with the plaque assay than with the limiting dilution assay. This difference arose because the CCID₅₀/PFU ratio in HeLa cells increased with the number of replacement codons, from 1.1 (ABCD) to 5.4 (abcd).

Alterations in the primary sequence of the viral genome might affect the levels of RNA in infected HeLa cells, either by modifying the rates of RNA synthesis or by changing the stabilities of the intracellular viral RNA molecules. To investigate this possibility, we measured total levels of viral RNA present in infected HeLa cells at 2-h intervals from 0 to 12 h in the single-step growth experiments described above (Fig. 4). Viral RNAs were measured by quantitative PCR, using primers targeting 3D^pol sequences shared among all viruses. After 12 h, total viral RNA yields were highest (915 ng/ml; equivalent to ∼57,000 RNA molecules/cell) for ABCD, lower (569 ng/ml; ∼35,000 RNA molecules/cell) for ABCd, and lowest (330 ng/ml; ∼20,000 RNA molecules/cell) for abcd (Fig. 6). Plaque yields, in contrast, followed a steeper downward trend, from ∼130 PFU/cell (ABCD) to ∼30 PFU/cell (ABCd) and ∼2 PFU/cell (abcd) (Fig. 3B and 4). Combining these values, we obtained yields of ∼440 RNA molecules/PFU (ABCD), ∼1,200 RNA molecules/PFU (ABCd), and ∼10,000 RNA molecules/PFU (abcd). Although the RNA molecule/PFU ratios were similar to the particle/PFU ratios determined above for each virus, the number of RNA molecules produced in infected cells is typically about twice the number of virus particles, because only about 50% of the viral RNA products are encapsidated (22). Nonetheless, the two sets of values clearly followed similar trends, as RNA yields and specific virus infectivities declined with increased numbers of replacement codons.

The differences in specific infectivities of the virus particles appear to be largely attributable to differences in the specific infectivities of the viral RNAs. When HeLa monolayers were transfected with equivalent quantities of transcripts from constructs ABCD, ABCd, and abcd and incubated under single-step growth conditions, the relative infectivity yields (CCID₅₀; HeLa cells) were 1.0 (ABCD), 0.18 (ABCd), and 0.016 (abcd).

Because the particle/PFU (or RNA molecule/PFU) ratios were higher for the codon replacement viruses than for the unmodified ABCD prototype, substantially more ABCd and abcd virion particles were used to initiate the single-step growth infections, even though the input MOIs varied over a narrow (approximately fourfold) range (Fig. 4). Consequently, the initial input encapsidated RNA levels were high for ABCd and very high for abcd, such that the extent of amplification of viral RNA at 12 h was ∼4,000-fold for ABCD, ∼1,000-fold for ABCd, and only ∼20-fold for abcd (Fig. 6).

We examined the stabilities of the plaque and single-step growth yield phenotypes of the ABCD, ABCd, and abcd viruses during serial passage in HeLa cells. Each virus was passaged 25 times (at 35°C for 36 h) in HeLa cell monolayers, with the input MOI varying from 0.1 to 0.4 PFU/cell; each passage represented at least two infectious cycles. Every fifth passage, virus plaque areas, plaque yields, and the genomic sequences of the bulk virus populations were determined, and the MOI was readjusted to ∼0.1 PFU/cell.

All three viruses evolved during serial passage, as measured by increasing plaque sizes, increasing virus yields, and changing genomic sequences (Table 3; Fig. 7). The evolution of the ABCD prototype was the least complex. Plaque areas increased approximately sixfold from passage 0 to passage 15, and this was accompanied by nucleotide substitutions at six sites. In contrast, virus yields increased 2.5-fold over the 25 passages. Two substitutions were fixed by passage 10, three more were fixed by passage 15, and all six substitutions were fixed by passage 20 (Table 3). Mixed bases were found at passages 5, 10, and 15. We found no evidence of back mutation or serial substitution at a site. All substitutions mapped to the coding region, and two of the six (33%) mapped to the capsid region, which is close to the proportion of capsid region sequences in the genome (35.4%). In distinct contrast to the pattern of poliovirus evolution in humans, where the large majority of base substitutions generate synonymous codons (43), all six of the observed base substitutions generated amino acid replacements (Table 3). None of the substitutions involved the loss of a CG dinucleotide.

The evolution of the codon replacement constructs was much more complex and dynamic. In ABCd, four of the eight (50%) variable positions mapped to VP1 (12.1% of the genome), and three of these four mapped within codon replacement cassette d (9.2% of the genome) (Table 3). Substitutions at half of the positions involved the apparent loss of CG dinucleotides (6.3% of the total genome), although in all instances the loss from the virus population was incomplete. One cassette d substitution (G₃₁₂₀→A) eliminating a CG dinucleotide represented a back mutation to the original synonymous codon. Virus ABCd resembled the ABCD prototype in that six of the eight nucleotide substitutions generated amino acid replacements. In contrast, ABCd differed markedly from the ABCD prototype in other ways, as the dynamics of substitution had apparently not stabilized by passage 25, and mixed bases were found at all eight positions of variability (Table 3). Active sequence evolution was accompanied by progressively increasing plaque areas over an approximately sixfold range, while virus yields fluctuated over a narrower, approximately twofold range (Fig. 7).

The evolution of abcd was the most dynamic, as determined by expanding plaque areas, rising virus yields, and increasing numbers of observed nucleotide substitutions. Plaque areas increased ∼15-fold from passage 0 to passage 15 and then stabilized (Fig. 7). Virus yields increased most sharply (approximately fourfold) between passages 5 and 10 but remained approximately fourfold lower than those of ABCD and ABCd at passage 25 (Fig. 7B). Among the 13 sites of nucleotide variability, most (11/13; 84.6%) mapped to the capsid region, all within the codon replacement interval; eight mapped within the VP1 region, three mapped within the VP2 region, and none mapped within the VP3 region (Table 3). As with the other constructs, most (8/13; 61.5%) of the substitutions encoded amino acid replacements. Substitutions at six sites involved a partial, transient, or complete loss of CG dinucleotides. As in ABCd, a G₃₁₂₀→A substitution eliminated a CG dinucleotide and restored the original Sabin 2 base. This same reversion was observed in eight other independent passages of abcd virus (data not shown). The two variable sites outside the capsid region stabilized with new substitutions by HeLa cell passage 20, whereas 8 of the 11 variable sites within the capsid region still had mixed bases at passage 25. Interestingly, no substitutions were found in the 3D^pol region, even though it constitutes 26% of the total genome. Apart from the back mutation at position 3120, all other variable sites differed between ABCD, ABCd, and abcd. No net changes were observed at sites A₄₈₁ (in the 5′ UTR) and U₂₉₀₉ (in the VP1 region), which are known to be subject to strong negative selection when Sabin 2 replicates in the human intestine (44, 49, 78, 79), and no changes were found at other sites known to vary upon propagation of Sabin 2 in cell culture (69).

In addition to the elimination of several CG dinucleotides, there was also a net loss (one lost, five partially lost, and one gained) of UA dinucleotides in the high-passage isolates (Table 3). In the codon replacement constructs, the elimination of UA dinucleotides was incomplete up to passage 25. Most (four of six) UA losses involved amino acid replacements. Unlike codons most frequently associated with a loss of CG dinucleotides, none of the codons associated with a loss of UA dinucleotides were replacement codons. While not as strongly suppressed as CG dinucleotides, UA dinucleotides are underrepresented in poliovirus genomes (61, 70) and human genes (34).

Most (8 of 13) of the capsid amino acid replacements mapped within or near surface determinants forming neutralizing antigenic (NAg) sites (Table 3). Although surface determinants are generally the most variable (70), amino acid replacements also occurred in naturally variable nonsurface residues in VP1 (Lys→Glu) and 2A^pro (Ser→Arg). Most of the synonymous mutations mapped to codons for conserved amino acids. However, several of the amino acid replacements, including five of the six in ABCD, were mutations to nonconsensus residues (Table 3).

Sequence evolution in HeLa cells of the unmodified ABCD virus differed in important respects from that of the codon replacement ABCd and abcd viruses. Nucleotide substitutions in the ABCD progeny were dispersed across the ORF, dimorphic variants emerged in the early passages, all six mutations were fixed by passage 20, and a single dominant master sequence emerged. In contrast, populations of the ABCd and abcd progeny were complex mixtures of variants at least up to passage 25, and the majority base at the variable sites typically fluctuated from passage to passage. Apparently, the incorporation of nonpreferred codons into the ABCd and abcd genomes led to an expansion of the mutant spectrum (14) and to the emergence of complex and unstable quasispecies populations. Because we have not attempted to isolate separate variants from the mixed populations, we do not know the phenotypes of individual sequence variants within the quasispecies.

The genomic RNAs of polioviruses and other enteroviruses appear to have relaxed secondary structures outside the 5′ UTR, the 3′ UTR, and the cis-acting replication element (CRE) within the 2C region (54, 73). Accordingly, under physiological conditions, most bases within the ORF can pair with more than one partner, and poliovirus genomes can fold into many different secondary structures having similar thermodynamic stabilities (54). However, the incorporation of numerous base substitutions into the codon replacement constructs and the concomitant increase in G+C content might destabilize folding patterns that had been subject to natural selection and stabilize other pairings absent from the unmodified Sabin 2 genome. To investigate the effects of codon replacement on RNA folding patterns, we compared the predicted secondary structures of the complete genomes of ABCD, ABCd, and abcd calculated using the mfold v. 3.1 algorithm (47, 54, 73, 82). The calculated global thermodynamic stabilities (expressed as minimum free energies at 35°C [ΔG_35°C], or MinE) of the RNA secondary structures increased with increasing G+C contents (for ABCD, ΔG_35°C = −2,047 kcal/mol; for ABCd, ΔG_35°C = −2,078 kcal/mol; and for abcd, ΔG_35°C = −2,191 kcal/mol), and the number of predicted stem structures increased from 546 (ABCD) to 557 (ABCd) and 562 (abcd). Much of the increased thermodynamic stability of the abcd RNA is attributable to more extensive folding within the P1/capsid region. Because the in vivo pairings are likely to be flexible and dynamic, many suboptimal structures are predicted to have nearly equivalent thermodynamic stabilities to those of the MinE structures (47, 54, 82). When the suboptimal structures (ΔΔG_35°C of up to +12 kcal/mol) were considered, the abcd RNA was again predicted to have a higher likelihood of folding within the P1/capsid region than the ABCD and ABCd RNAs. It is difficult to assess rigorously the structural contributions of the nucleotide substitutions that accumulated during serial passage of the ABCd and abcd viruses because the final progeny were mixed populations. However, when we analyzed the majority base sequence for each final passage population, the calculated MinE values and the numbers of stem structures were similar between each pair of parental and progeny RNAs. Moreover, the higher-fitness abcd progeny was predicted to have retained the tendency for increased folding in the P1/capsid region. Although some preferred short-range and long-range pairings varied among the different RNAs, the stable secondary structures in the 5′ UTR, the 3′ UTR, and the CRE were predicted to be unaltered.