Highlights
- •
Migrating HFSCs activate CD80 during cutaneous wound repair
- •
CD80 deficiency in HFSCs causes delayed wound healing
- •
HFSCs acquire CD80 to expand extrathymic regulatory T cells
- •
HFSC and Treg cell interactions prevent accumulation of neutrophils
Summary
Graphical abstract
Keywords
Introduction
- Gonzales K.A.U.
- Polak L.
- Matos I.
- Tierney M.T.
- Gola A.
- Wong E.
- Infarinato N.R.
- Nikolova M.
- Luo S.
- Liu S.
- et al.
- Hsu Y.C.
- Fuchs E.
- Aragona M.
- Dekoninck S.
- Rulands S.
- Lenglez S.
- Mascré G.
- Simons B.D.
- Blanpain C.
Results
HFSCs activate immune-modulatory programs during wound repair
- Gonzales K.A.U.
- Polak L.
- Matos I.
- Tierney M.T.
- Gola A.
- Wong E.
- Infarinato N.R.
- Nikolova M.
- Luo S.
- Liu S.
- et al.
- Gonzales K.A.U.
- Polak L.
- Matos I.
- Tierney M.T.
- Gola A.
- Wong E.
- Infarinato N.R.
- Nikolova M.
- Luo S.
- Liu S.
- et al.
- Vagaska B.
- New S.E.
- Alvarez-Gonzalez C.
- D'Acquisto F.
- Gomez S.G.
- Bulstrode N.W.
- Madrigal A.
- Ferretti P.
- Gonzales K.A.U.
- Polak L.
- Matos I.
- Tierney M.T.
- Gola A.
- Wong E.
- Infarinato N.R.
- Nikolova M.
- Luo S.
- Liu S.
- et al.
- Gonzales K.A.U.
- Polak L.
- Matos I.
- Tierney M.T.
- Gola A.
- Wong E.
- Infarinato N.R.
- Nikolova M.
- Luo S.
- Liu S.
- et al.
CD80 expressed by wound-activated skin SCs is essential to repair cutaneous wounds
CD80 in HFSCs orchestrates Treg cell responses at the wound bed to drive re-epithelialization
Epithelial SCs prevent Neu accumulation near the wound site
HFSCs facilitate the expansion of extrathymic Treg cells in the wound
HFSCs trigger Treg cell induction from pre-activated CD4 T cells in a CD80 dependent but MHC-class II-independent manner
HFSCs balance inflammation and immune tolerance during wound repair
- Konieczny P.
- Xing Y.
- Sidhu I.
- Subudhi I.
- Mansfield K.P.
- Hsieh B.
- Biancur D.E.
- Larsen S.B.
- Cammer M.
- Li D.
- et al.
Discussion
- Gonzales K.A.U.
- Polak L.
- Matos I.
- Tierney M.T.
- Gola A.
- Wong E.
- Infarinato N.R.
- Nikolova M.
- Luo S.
- Liu S.
- et al.
- Lay K.
- Yuan S.
- Gur-Cohen S.
- Miao Y.
- Han T.
- Naik S.
- Pasolli H.A.
- Larsen S.B.
- Fuchs E.
- Gonzales K.A.U.
- Polak L.
- Matos I.
- Tierney M.T.
- Gola A.
- Wong E.
- Infarinato N.R.
- Nikolova M.
- Luo S.
- Liu S.
- et al.
- Lay K.
- Yuan S.
- Gur-Cohen S.
- Miao Y.
- Han T.
- Naik S.
- Pasolli H.A.
- Larsen S.B.
- Fuchs E.
Limitations of the study
STAR★Methods
Key resources table
REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
APC anti-mouse CD4, rat monoclonal (clone GK1.5) | Biolegend | Cat# 100412; RRID: AB_312697 |
PE/Cy7 anti-mouse CD4, rat monoclonal (clone GK1.5) | Biolegend | Cat# 100422; RRID: AB_312707 |
APC/Cy7 anti-mouse CD8b, rat monoclonal (clone YTS156.7.7) | Biolegend | Cat# 126620; RRID: AB_2563951 |
AF700 anti-mouse CD45, rat monoclonal (clone 30-F11) | Biolegend | Cat# 103128; RRID: AB_493715 |
APC/Cy7 anti-mouse CD45, rat monoclonal (clone 30-F11) | Biolegend | Cat# 103116; RRID: AB_312981 |
PE anti-mouse CD45, rat monoclonal (clone 30-F11) | Biolegend | Cat# 103106; RRID: AB_312971 |
FITC anti-mouse CD45, rat monoclonal (clone 30-F11) | Biolegend | Cat# 103108; RRID: AB_312973 |
APC/Cy7 anti-mouse CD44, rat monoclonal (clone IM7) | Biolegend | Cat# 103028; RRID: AB_830785 |
BV711 anti-mouse CD62L, rat monoclonal (clone MEL-14) | Biolegend | Cat# 104445; RRID: AB_2564215 |
PE anti-mouse CD45.1, mouse monoclonal (clone A20) | Biolegend | Cat# 110707; RRID: AB_313496 |
PE/Cy7 anti-mouse CD45.1, mouse monoclonal (clone A20) | Biolegend | Cat# 110730; RRID: AB_1134168 |
APC/Cy7 anti-mouse CD45.2, mouse monoclonal (clone 104) | Biolegend | Cat# 109824; RRID: AB_830789 |
Pacific Blue anti-mouse CD11b, rat monoclonal (clone M1/70) | Biolegend | Cat# 101224; RRID: AB_755986 |
PerCP/Cy5.5 anti-mouse CD11b, rat monoclonal (clone M1/70) | Biolegend | Cat# 101228; RRID: AB_893232 |
PE/Cy7 anti-mouse CD11c, armenian hamster monoclonal (clone N418) | Biolegend | Cat# 117318; RRID: AB_493568 |
APC anti-mouse CD80, Armenian hamster monoclonal (clone 16-10A1) | Biolegend | Cat# 104714; RRID: AB_313135 |
AF700 anti-mouse I-A/I-E, rat monoclonal (clone M5/114.15.2) | Biolegend | Cat# 107622; RRID: AB_493727 |
PE/Cy7 anti-mouse integrin α5, rat monoclonal (clone 5H10-27 (MFR5) | Biolegend | Cat# 103816; RRID: AB_2734165 |
BV711 anti-mouse TCR β Chain, armenian hamster monoclonal (clone H57-597) | Biolegend | Cat# 109243; RRID: AB_2629564 |
PE anti-mouse TCR γ/δ, armenian hamster monoclonal (clone GL3) | Biolegend | Cat# 118108; RRID: AB_313832 |
PerCP/Cy5.5 anti-mouse Ki67, rat monoclonal (clone 16A8) | Biolegend | Cat# 652424; RRID: AB_2629531 |
PE anti-mouse IL-2, rat monoclonal (clone JES6-5H4) | Biolegend | Cat# 503808; RRID: AB_315302 |
PerCP/Cy5.5 anti-mouse IL17A, rat monoclonal (clone TC11-18H10.1) | Biolegend | Cat# 506920; RRID: AB_961384 |
FITC anti-mouse IFN-γ, rat monoclonal (clone XMG1.2) | Biolegend | Cat# 505806; RRID: AB_315400 |
FITC anti-mouse Ly-6C, rat monoclonal (clone HK1.4) | Biolegend | Cat# 128006; RRID: AB_1186135 |
PerCP/Cy5.5 anti-mouse Ly-6C, rat monoclonal (clone HK1.4) | Biolegend | Cat# 128011; RRID: AB_1659242 |
PE anti-mouse Ly-6G, rat monoclonal (clone 1A8) | Biolegend | Cat# 127608; RRID: AB_1186099 |
BV711 anti-mouse CD64, mouse monoclonal (clone X54-5/7.1) | Biolegend | Cat# 139311; RRID: AB_2563846 |
APC anti-mouse Foxp3, rat monoclonal (clone FJK-16s) | ThermoFisher Scientific | Cat# 17-1577-82; RRID: AB_469457 |
Biotin conjugated anti-CD11b, rat monoclonal (clone M1/70 ) | Biolegend | Cat# 101204; RRID: AB_312787 |
Biotin conjugated anti-CD45, rat monoclonal (clone 30-F11) | Biolegend | Cat# 103104; RRID: AB_312969 |
Biotin conjugated anti-CD31, rat monoclonal (clone MEC13.3) | Biolegend | Cat# 102504; RRID: AB_312911 |
Biotin conjugated anti-CD117, rat monoclonal (clone 2B8) | Biolegend | Cat# 105804; RRID: AB_313213 |
Biotin conjugated anti-CD140a, rat monoclonal (clone APA5) | Biolegend | Cat# 135910; RRID: AB_2043974 |
APC armenian Hamster IgG Isotype Control (clone: HTK888) | Biolegend | Cat# 400911; RRID: AB_2905474 |
AF700 rat IgG2b κ Isotype Control (clone: RTK4530) | Biolegend | Cat# 400628; RRID: AB_493783 |
Purified anti-mouse CD3, rat monoclonal (clone 17A2) | Biolegend | Cat# 100202; RRID: AB_312659 |
Anti-GFP, rabbit polyclonal | Abcam | Cat# ab290; RRID: AB_2313768 |
Purified anti-Keratin 14, chicken polyclonal (clone Poly9060) | Biolegend | Cat# 906004; RRID: AB_2616962 |
Purified anti-Keratin 10, rabbit polyclonal (clone Poly19054) | Biolegend | Cat# 905404; RRID: AB_2616955 |
Purified anti-integrin α5, rat monoclonal (clone 5H10-27 (MFR5)) | BD Biosciences | Cat# 553319; RRID: AB_394779 |
Purified anti-Ly6G, rat monoclonal (clone 1A8) | Biolegend | Cat# 127602; RRID: AB_1089180 |
Anti-mouse CD80, goat polyclonal | R&D systems | Cat# AF740, RRID: AB_2075997 |
AF488 anti-rabbit IgG, donkey polyclonal | Jackson ImmunoResearch Laboratories | Cat# 711-545-152; RRID: AB_2313584 |
AF488 anti-chicken IgG, donkey polyclonal | Jackson ImmunoResearch Laboratories | Cat# 703-545-155; RRID: AB_2340375 |
AF488 anti-goat IgG, donkey polyclonal | Jackson ImmunoResearch Laboratories | Cat# 705-545-147; RRID: AB_2336933 |
AF647 anti-rabbit IgG, donkey polyclonal | Jackson ImmunoResearch Laboratories | Cat# 711-605-152; RRID: AB_2492288 |
AF647 anti-chicken IgG, donkey polyclonal | Jackson ImmunoResearch Laboratories | Cat# 703-605-155; RRID: AB_2340379 |
RRX anti-rat IgG, donkey polyclonal | Jackson ImmunoResearch Laboratories | Cat# 712-295-150; RRID: AB_2340675 |
CD3e monoclonal antibody (clone 145-2C11) | ThermoFisher Scientific | Cat# 14-0031-82; RRID: AB_467049 |
CD28 monoclonal antibody (clone 37.51) | ThermoFisher Scientific | Cat# 16-0281-82; RRID: AB_468921 |
Mouse CXCL5 antibody, rat monoclonal (clone 61905) | R&D Systems | Cat# MAB433; RRID: AB_2086587 |
Chemicals, peptides, and recombinant proteins | ||
Tamoxifen | Sigma-Aldrich | Cat# T5648 |
Diptheria toxin | Sigma-Aldrich | Cat# D0654 |
TRIzol | ThermoFisher Scientific | Cat# 15596026 |
Liberase | Sigma-Aldrich | Cat# 5401020001 |
Deoxyribonuclease I from bovine pancreas | Sigma-Aldrich | Cat# D4263 |
Zombie Aqua viability dye | Biolegend | Cat# 423101 |
Cell stimulation cocktail | ThermoFisher Scientific | Cat# 00-4970-03 |
Brefeldin A | ThermoFisher Scientific | Cat# 00-4506-51 |
2-Mercaptoethanol | ThermoFisher Scientific | Cat# 21985-023 |
HEPES buffer | Corning | Cat# 25-060-C1 |
Penicillin-Streptomycin | ThermoFisher Scientific | Cat# 15140122 |
MEM | ThermoFisher Scientific | Cat# 11140-050 |
Sodium pyruvate | Corning | Cat# 25-000-C1 |
Gentamicin | ThermoFisher Scientific | Cat# 15710-064 |
Mitomycin C | Fisher Bioreagents | Cat# BP25312 |
OVA 323-339 | InvivoGen | Cat# vac-isq |
DQ Ovalbumin | ThermoFisher Scientific | Cat# D12053 |
Recombinant Mouse IL-2 | R&D Systems | Cat# 402-ML-020 |
Mouse TGFβ | Cell Signaling Technology | Cat# 5231LF |
Critical commercial assays | ||
MojoSort mouse CD4 naive T cell isolation kit | Biolegend | Cat# 480040 |
Foxp3/Transcriptional factor staining buffer set | ThermoFisher Scientific | Cat# 00-5521-00 |
RNAscope Multiplex Fluorescent Reagent Kit v2 | Advanced Cell Diagnostics | Cat# 323100 |
RNAscope Probe-Mm-Cxcl5-C1 | Advanced Cell Diagnostics | Cat# 467441 |
Direct-zol RNA Miniprep Kit | Zymo Research | Cat# 11-331 |
NEBNext Single Cell/Low input RNA library prep kit for Illumina | New England Biolabs | Cat# E6420S |
Illumina Tagment DNA Enzyme and Buffer kits | Illumina | Cat# 15027866 |
MiniElute PCR Purification Kit | Qiagen | Cat# 28004 |
Deposited data | ||
RNA-sequencing data | This paper | GEO: GSE220241 |
ATAC-sequencing data | This paper | GEO: GSE220241 |
Single cell RNA-sequencing data | Haensel et al.
26
|
GEO: GSE142471 |
Experimental models: Organisms/strains | ||
Mouse: K14CreER | Fuchs lab | N/A |
Mouse: K14cre | Fuchs lab | N/A |
Mouse: Sox9CreER | Fuchs lab | N/A |
Mouse: Foxp3ΔCNS1-GFP | Rudensky lab | N/A |
Mouse: Foxp3tm2Ayr | Rudensky lab | N/A |
Mouse: C57BL/6J | The Jackson Laboratory | Cat# 000664 |
Mouse: B6;129S6-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J | The Jackson Laboratory | Cat# 007905 |
Mouse: B6.129S4-Cd80tm1Shr/J | The Jackson Laboratory | Cat# 003611 |
Mouse: B6;129-Gt(ROSA) 26Sortm1(CAG-cas9∗,-EGFP)Fezh/J | The Jackson Laboratory | Cat# 248857 |
Mouse: B6.129(Cg)-FOXP3tm3(DTR/GFP)Ayr/J | The Jackson Laboratory | Cat# 016958 |
Mouse: Foxp3CreER-GFP | The Jackson Laboratory | Cat# 016961 |
Mouse: B6(Cf)-Rag2tm1.1Gn/J | The Jackson Laboratory | Cat# 008449 |
Mouse: B6.Cg-Tg(TcraTcrb)425Cbn/J | The Jackson Laboratory | Cat# 004194 |
Mouse: B6.SJL-Ptprca Pepcb/Boyd | The Jackson Laboratory | Cat# 002014 |
Mouse: B6.129X1-H2-Ab1 tm1Koni/J | The Jackson Laboratory | Cat# 013181 |
Mouse: B6.129S2-H2dlAb1-Ea/J | The Jackson Laboratory | Cat# 003584 |
Oligonucleotides | ||
Mouse Cd80 sgRNA1: CATCAATACGACAATTTCCC | Miao et al.
20
|
N/A |
Mouse Cd80 sgRNA2: CGTGTCAGAGGACTTCACCT | Miao et al.
20
|
N/A |
Recombinant DNA | ||
pLKO-H2BGFP-CD80 sgRNA | Miao et al.
20
|
N/A |
Software and algorithms | ||
Fuji (Image J) | Fuji (Image J) | https://fiji.sc/ |
FlowJo | FlowJo | https://www.flowjo.com |
Biorender | Biorender | www.biorender.com |
Cutadapt (v3.2) | Martin
38
|
https://cutadapt.readthedocs.io/en/v3.4/ |
Pseudo-aligner Kallisto (v0.44.0) | Bray et al.
39
|
https://github.com/pachterlab/kallisto |
DESeq2 R package (v1.30.0) | Love et al.
40
Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2.
Genome Biol. 2014; 15550https://doi.org/10.1186/s13059-014-0550-8
|
https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
clusterProfiler package | Yu et al.
41
|
https://guangchuangyu.github.io/software/clusterProfiler/ |
MSigDB (Molecular signature database, v7.4) | Broad Institute | https://www.gsea-msigdb.org/gsea/msigdb |
Bowtie2 (v2.3.4.3) | Langmead and Salzberg
42
|
http://bowtie-bio.sourceforge.net/owtie2/index.shtml |
Picard (v2.18.7) | Broad Institute | http://github.com/broadinstitute/picard/releases/tag/2.7.1 |
DeepTools | Ramirez et al.
43
|
https://pypi.org/project/deepTools/ |
Gviz package | Hahne and Ivanek
44
|
https://github.com/ivanek/Gviz |
MACS2 (v2.2.7.1) | Zhang et al.
45
Model-based analysis of ChIP-Seq (MACS).
Genome Biol. 2008; 9R137https://doi.org/10.1186/gb-2008-9-9-r137
|
https://pypi.org/project/MACS2/ |
Bedtools (v2.30.0) | Quinlan and Hall
46
|
https://bedtools.readthedocs.io/en/latest/ |
FeatureCounts (v1.5.3) | Liao et al.
47
|
https://subread.sourceforge.net |
Seurat (v.4.1.0) | Hao et al.
48
|
https://github.com/satijalab/seurat |
R | R Project | https://www.r-project.org/ |
RStudio | Posit | https://posit.co/download/rstudio-desktop/ |
Other | ||
BD FACSAria II Cell Sorter | BD Biosciences | N/A |
BD LSR II Analyzer | BD Biosciences | N/A |
BD LSR-Fortessa analyzer | BD Biosciences | N/A |
Axio Observer Z1 | Zeiss | N/A |
Leica Stellaris 8 Confocal microscope | Leica | N/A |
Resource availability
Lead contact
Materials availability
Data and code availability
- •
Bulk RNA-seq and ATAC-seq data have been deposited at GEO and are publicly available as of the date of publication. Accession numbers are listed in the key resources table.
- •
Microscopy data and flow cytometry data reported in this paper will be shared by the lead contact upon request.
- •
This paper does not report original code and any additional information or data in this paper will be available from the lead contact upon request.
Experimental model and study participants details
Mice
Cell Lines
Method details
In utero lentiviral transduction
Bone marrow chimera construction
Partial thickness wound
Flow Cytometry
Immunofluorescence and RNA scope staining
Electron Microscopy
In vitro co-culture
RNA isolation and sequencing library preparation
ATAC-Seq library preparation
Next generation sequencing data analysis
RNA-Seq Alignment and Differential Expression Analysis
- Love M.I.
- Huber W.
- Anders S.
Gene Set Enrichment Analysis (GSEA)
ATAC-seq
- Zhang Y.
- Liu T.
- Meyer C.A.
- Eeckhoute J.
- Johnson D.S.
- Bernstein B.E.
- Nusbaum C.
- Myers R.M.
- Brown M.
- Li W.
- Liu X.S.
Single cell RNA-seq
Statistics
Data and Software Availability
Acknowledgments
Author contributions
Declaration of interests
Supplemental information
-
Document S1. Figures S1–S5
References
-
Tissue stem cells: architects of their niches.Cell Stem Cell. 2020; 27: 532-556https://doi.org/10.1016/j.stem.2020.09.011
-
Stem cells expand potency and alter tissue fitness by accumulating diverse epigenetic memories.Science. 2021; 374eabh2444https://doi.org/10.1126/science.abh2444
-
Inflammatory memory and tissue adaptation in sickness and in health.Nature. 2022; 607: 249-255https://doi.org/10.1038/s41586-022-04919-3
-
Inflammatory memory sensitizes skin epithelial stem cells to tissue damage.Nature. 2017; 550: 475-480https://doi.org/10.1038/nature24271
-
Building and maintaining the skin.Cold Spring Harb. Perspect. Biol. 2022; 14a040840https://doi.org/10.1101/cshperspect.a040840
-
Skin and its regenerative powers: an alliance between stem cells and their niche.Dev. Cell. 2017; 43: 387-401https://doi.org/10.1016/j.devcel.2017.10.001
-
Defining stem cell dynamics and migration during wound healing in mouse skin epidermis.Nat. Commun. 2017; 814684https://doi.org/10.1038/ncomms14684
-
Self-renewal, multipotency, and the existence of two cell populations within an epithelial stem cell niche.Cell. 2004; 118: 635-648https://doi.org/10.1016/j.cell.2004.08.012
-
A tissue injury sensing and repair pathway distinct from host pathogen defense.Cell. 2023; 186: 2127-2143.e22https://doi.org/10.1016/j.cell.2023.03.031
-
Identification of stem cell populations in sweat glands and ducts reveals roles in homeostasis and wound repair.Cell. 2012; 150: 136-150https://doi.org/10.1016/j.cell.2012.04.045
-
The epidermis comprises autonomous compartments maintained by distinct stem cell populations.Cell Stem Cell. 2013; 13: 471-482https://doi.org/10.1016/j.stem.2013.07.010
-
Involvement of follicular stem cells in forming not only the follicle but also the epidermis.Cell. 2000; 102: 451-461https://doi.org/10.1016/s0092-8674(00)00050-7
-
Stem cell lineage infidelity drives wound repair and cancer.Cell. 2017; 169: 636-650.e14https://doi.org/10.1016/j.cell.2017.03.042
-
Immune privilege of skin stem cells: what do we know and what can we learn?.Exp. Dermatol. 2021; 30: 522-528https://doi.org/10.1111/exd.14221
-
Immune privilege of stem cells.Methods Mol. Biol. 2013; 1029: 1-16https://doi.org/10.1007/978-1-62703-478-4_1
-
Hair follicle immune privilege revisited: the Key to alopecia areata management.J. Investig. Dermatol. Symp. Proc. 2018; 19: S12-S17https://doi.org/10.1016/j.jisp.2017.10.014
-
The hair follicle and immune privilege.J. Investig. Dermatol. Symp. Proc. 2003; 8: 188-194https://doi.org/10.1046/j.1087-0024.2003.00807.x
-
Regulatory T cells in skin facilitate epithelial stem cell differentiation.Cell. 2017; 169: 1119-1129.e11https://doi.org/10.1016/j.cell.2017.05.002
-
Glucocorticoid signaling and regulatory T cells cooperate to maintain the hair-follicle stem-cell niche.Nat. Immunol. 2022; 23: 1086-1097https://doi.org/10.1038/s41590-022-01244-9
-
Adaptive immune resistance emerges from tumor-initiating stem cells.Cell. 2019; 177: 1172-1186.e14https://doi.org/10.1016/j.cell.2019.03.025
-
MHC-class-II are expressed in a subpopulation of human neural stem cells in vitro in an IFNgamma-independent fashion and during development.Sci. Rep. 2016; 624251https://doi.org/10.1038/srep24251
-
T helper cell cytokines modulate intestinal stem cell renewal and differentiation.Cell. 2018; 175: 1307-1320.e22https://doi.org/10.1016/j.cell.2018.10.008
-
Single-cell multi-omics analysis of human pancreatic islets reveals novel cellular states in type 1 diabetes.Nat. Metab. 2022; 4: 284-299https://doi.org/10.1038/s42255-022-00531-x
-
Atypical MHC class II-expressing antigen-presenting cells: can anything replace a dendritic cell?.Nat. Rev. Immunol. 2014; 14: 719-730https://doi.org/10.1038/nri3754
-
Molecular mechanisms regulating TGF-beta-induced Foxp3 expression.Mucosal Immunol. 2010; 3: 230-238https://doi.org/10.1038/mi.2010.7
-
Defining epidermal basal cell states during skin homeostasis and wound healing using single-cell transcriptomics.Cell Rep. 2020; 30: 3932-3947.e6https://doi.org/10.1016/j.celrep.2020.02.091
-
Rapid functional dissection of genetic networks via tissue-specific transduction and RNAi in mouse embryos.Nat. Med. 2010; 16: 821-827https://doi.org/10.1038/nm.2167
-
The B7 family of ligands and its receptors: new pathways for costimulation and inhibition of immune responses.Annu. Rev. Immunol. 2002; 20: 29-53https://doi.org/10.1146/annurev.immunol.20.091101.091806
-
Regulatory T cells: mechanisms of differentiation and function.Annu. Rev. Immunol. 2012; 30: 531-564https://doi.org/10.1146/annurev.immunol.25.022106.141623
-
Regulatory T cells and human disease.Annu. Rev. Immunol. 2020; 38: 541-566https://doi.org/10.1146/annurev-immunol-042718-041717
-
Cutting edge: regulatory T cells facilitate cutaneous wound healing.J. Immunol. 2016; 196: 2010-2014https://doi.org/10.4049/jimmunol.1502139
-
Treg-cell control of a CXCL5-IL-17 inflammatory axis promotes hair-follicle-stem-cell differentiation during skin-barrier repair.Immunity. 2019; 50: 655-667.e4https://doi.org/10.1016/j.immuni.2019.02.013
-
Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T-cell fate.Nature. 2010; 463: 808-812https://doi.org/10.1038/nature08750
-
The gut microbiota promotes distal tissue regeneration via RORgamma(+) regulatory T cell emissaries.Immunity. 2023; 56: 829-846.e8https://doi.org/10.1016/j.immuni.2023.01.033
-
Interleukin-17 governs hypoxic adaptation of injured epithelium.Science. 2022; 377eabg9302https://doi.org/10.1126/science.abg9302
-
Stem cells repurpose proliferation to contain a breach in their niche barrier.eLife. 2018; 7e41661https://doi.org/10.7554/eLife.41661
-
Keratinocyte-intrinsic MHCII expression controls microbiota-induced Th1 cell responses.Proc. Natl. Acad. Sci. USA. 2019; 116: 23643-23652https://doi.org/10.1073/pnas.1912432116
-
Cutadapt removes adapter sequences from high-throughput sequencing reads.EMBnet J. 2011; 17: 10-12https://doi.org/10.14806/ej.17.1.200
-
Near-optimal probabilistic RNA-seq quantification.Nat. Biotechnol. 2016; 34: 525-527https://doi.org/10.1038/nbt.3519
-
Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2.Genome Biol. 2014; 15550https://doi.org/10.1186/s13059-014-0550-8
-
clusterProfiler: an R package for comparing biological themes among gene clusters.Omics. 2012; 16: 284-287https://doi.org/10.1089/omi.2011.0118
-
Fast gapped-read alignment with Bowtie 2.Nat. Methods. 2012; 9: 357-359https://doi.org/10.1038/nmeth.1923
-
deepTools: a flexible platform for exploring deep-sequencing data.Nucleic Acids Res. 2014; 42: W187-W191https://doi.org/10.1093/nar/gku365
-
Visualizing genomic data using Gviz and bioconductor.Methods Mol. Biol. 2016; 1418: 335-351https://doi.org/10.1007/978-1-4939-3578-9_16
-
Model-based analysis of ChIP-Seq (MACS).Genome Biol. 2008; 9R137https://doi.org/10.1186/gb-2008-9-9-r137
-
BEDTools: a flexible suite of utilities for comparing genomic features.Bioinformatics. 2010; 26: 841-842https://doi.org/10.1093/bioinformatics/btq033
-
featureCounts: an efficient general purpose program for assigning sequence reads to genomic features.Bioinformatics. 2014; 30: 923-930https://doi.org/10.1093/bioinformatics/btt656
-
Integrated analysis of multimodal single-cell data.Cell. 2021; 184: 3573-3587.e29https://doi.org/10.1093/bioinformatics/btt656
-
Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position.Nat. Methods. 2013; 10: 1213-1218https://doi.org/10.1093/bioinformatics/btt656
Article info
Publication history
Identification
Copyright
User license
Creative Commons Attribution (CC BY 4.0) |Permitted
- Read, print & download
- Redistribute or republish the final article
- Text & data mine
- Translate the article
- Reuse portions or extracts from the article in other works
- Sell or re-use for commercial purposes
Elsevier's open access license policy