Next Article in Journal
Medicinal Plants and Their Traditional Uses in Local Communities around Cherangani Hills, Western Kenya
Next Article in Special Issue
Validation of a Preformulated, Field Deployable, Recombinase Polymerase Amplification Assay for Phytophthora Species
Previous Article in Journal
Genome-Wide Identification and Expression Analysis of Polygalacturonase Gene Family in Kiwifruit (Actinidia chinensis) during Fruit Softening
Previous Article in Special Issue
A PCR, qPCR, and LAMP Toolkit for the Detection of the Wheat Blast Pathogen in Seeds
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 9
Issue 3
10.3390/plants9030329
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Phylogenetic Analysis and Development of Molecular Tool for Detection of Diaporthe citri Causing Melanose Disease of Citrus

by
Chingchai Chaisiri
1,2,
Xiang-Yu Liu
1,2,
Yang Lin
1,
Jiang-Bo Li
3,
Bin Xiong
3 and
Chao-Xi Luo
1,2,*
1
Key Lab of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University, Wuhan 430070, China
2
Department of Plant Pathology, College of Plant Science & Technology, and Key Lab of Crop Disease Monitoring & Safety Control in Hubei Province, Huazhong Agricultural University, Wuhan 430070, China
3
Nanfeng Citrus Research Institute, Nanfeng 344500, China
*
Author to whom correspondence should be addressed.
Plants 2020, 9(3), 329; https://doi.org/10.3390/plants9030329
Submission received: 16 February 2020 / Revised: 25 February 2020 / Accepted: 27 February 2020 / Published: 4 March 2020
(This article belongs to the Special Issue Detection and Diagnostics of Fungal and Oomycete Plant Pathogens)
Browse Figures
Versions Notes

Abstract

:
Melanose disease caused by Diaporthe citri is considered as one of the most important and destructive diseases of citrus worldwide. In this study, isolates from melanose samples were obtained and analyzed. Firstly, the internal transcribed spacer (ITS) sequences were used to measure Diaporthe-like boundary species. Then, a subset of thirty-eight representatives were selected to perform the phylogenetic analysis with combined sequences of ITS, beta-tubulin gene (TUB), translation elongation factor 1-α gene (TEF), calmodulin gene (CAL), and histone-3 gene (HIS). As a result, these representative isolates were identified belonging to D. citri, D. citriasiana, D. discoidispora, D. eres, D. sojae, and D. unshiuensis. Among these species, the D. citri was the predominant species that could be isolated at highest rate from different melanose diseased tissues. The morphological characteristics of representative isolates of D. citri were investigated on different media. Finally, a molecular tool based on the novel species-specific primer pair TUBDcitri-F1/TUBD-R1, which was designed from TUB gene, was developed to detect D. citri efficiently. A polymerase chain reaction (PCR) amplicon of 217 bp could be specifically amplified with the developed molecular tool. The sensitivity of the novel species-specific detection was upon to 10 pg of D. citri genomic DNA in a reaction. Therefore, the D. citri could be unequivocally identified from closely related Diaporthe species by using this simple PCR approach.

1. Introduction

Citrus and their allied genera (including Eremocitrus, Fortunella, Microcitrus, and Poncirus) are widely distributed worldwide, among them, the most popular cultivars belong to the Aurantioideae subfamily of the Rutaceae family. Allegedly, the citrus was originally cultivated in Himalayas 4000 years ago [1]. Nowadays, Citrus is one of the most widely cultivated fruit crops with a planting area of 2.5 million ha and production of more than 38 million tons per year in China [2]. The popular citrus cultivars in China include Citrus reticulata (mandarin), Citrus sinensis (sweet orange), Citrus grandis or Citrus maxima (pumelo), and Citrus paradisi (grapefruit) [3].
The Diaporthe genus fungi are well-known as saprobic-, endophytic-, and pathogenic-plant parasites on economically significant plant cultivars [4,5,6,7,8]. One host species can be affected by many different Diaporthe species, whereas one Diaporthe species can infect many hosts species [9,10,11,12,13]. Accurate identification of Diaporthe species is very important for controlling the diseases caused by these fungi and making effective quarantine strategies [14,15,16,17].
The Diaporthe citri (syn. Phomopsis citri) has a wide spectrum on several citrus species including mandarin, sweet orange, pumelo, grapefruit, and lemons [18]. A potential damage referred multiple symptoms e.g., wood canker, twig blight, brunch dieback, gummosis, stem-end rot, and melanose [18,19,20,21,22,23,24]. The melanose, one of the most serious citrus diseases caused by D. citri was firstly reported on citrus fruits in Florida [25]. In 1912, Fawcett [26] reported that stem-end rot was caused by Phomopsis citri, while Floyd and Stevens [27] provided the evidence that stem-end rot and melanose disease were infected by the same fungus. In 1914, a fungus Diaporthe citrincola was firstly collected and described from twigs of Citrus nobilis [28]. In 1917, Phomopsis caribaea was reported on twigs of grapefruit in Isle of Pines, Cuba [29]. In early studies, D. citri was reported in several names including Diaporthe medusaea [30], Phomopsis californica [31], and Phoma cytosporella [28]. In 1928, Bach and Wolf [32] fulfilled Koch’s postulates for D. citri infection on citrus. Pathogenicity test demonstrated that both conidiospore of P. citri and ascospore of D. citri could produce leaf melanose symptoms [33].
Traditional molecular barcoding for fungal species discrimination based on nuclear ribosomal internal transcribed spacer regions (ITS) is frequently used for the identification of Diaporthe genus [7,34,35,36]. The molecular phylogeny based on the combination of multi-locus DNA sequences showed better identification of Diaporthe species [6,20,37,38,39,40]. The combination of translation elongation factor 1-α gene (TEF), beta-tubulin gene (TUB), calmodulin gene (CAL), and histone-3 gene (HIS) showed good resolution for Diaporthe species discrimination [7,38,41]. Generally, molecular marker was used to detect Diaporthe species, and many species-specific primers were designed based on conserved ITS region such as in Diaporthe phaseolorum and Diaporthe longicolla from soybean [42], Diaporthe azadirachtae from neem [43,44], Diaporthe sclerotioides from plants and soils [45]. Also, a molecular tool based on TEF gene was developed to detect Diaporthe azadirachtae from neem [46]. However, these methods are hard to distinguish D. citri and its closely related species because only limited informative variations could be found in both the ITS region and TEF gene, thus, it is hard to design specific primers based on these sequences to distinguish D. citri from other Diaporthe species.
The aims of this study was to: (i) to define the species discrimination of D. citri based on phylogenetic analyses and (ii) to develop a molecular tool to simply detect D. citri from multiple Diaporthe species on citrus plants.

2. Results

2.1. Isolation of Diaporthe Species

Totally 140 isolates were obtained and 38 representative isolates from different tissues, i.e., leaves, fruits, and twigs were selected for further study (Table 1; Figure 1). The identification based on ITS sequence analysis showed that all these isolates belong to Diaporthe species (Supplementary Figure S1).

2.2. Geographic Distribution of D. citri

According to the Systematic Mycology and Microbiology Laboratory, ARS, USDA (SMML database), D. citri has been recorded on citrus cultivars and their allied genera worldwide. The D. citri is a dominant species in Diaporthe genus, which occurs widely in citrus-growing countries, e.g., China, Philippines, Japan, Korea, Thailand, Myanmar, Cambodia, Fiji, Mauritius, USA, Mexico, Haiti, Cuba, Dominican, Panama, Puerto Rico, Venezuela, Trinidad and Tobago, Brazil, Cyprus, Portugal (Azores Islands), New Zealand, Niue, Samoa, Tonga, Cook Islands, Cote d’Ivoire, and Zimbabwe. The detailed citrus host and their allied genera of Diaporthe spp., are shown in Figure 2 and Supplementary Table S1.

2.3. Phylogenetic Analysis of Diaporthe Species

Totally 3183 base pairs (bp) of combined DNA sequences were obtained for phylogenetic analysis, including 645 bp ITS sequence (1–645), 472 bp TEF gene sequence (650–1121), 893 bp TUB gene sequence (1126–2018), 617 bp CAL gene sequence (2023–2639), and 540 bp HIS gene sequence (2644–3183). Combined data set consisted of 129 taxa including the outgroup species of Diaporthella corylina (CBS 121124). Six phylogenetic trees were constructed corresponding to each single-locus analysis of ITS, TEF, TUB, CAL, HIS, and combined data of five loci (Figure 3, Supplementary Figures S1 and S2). The combined data set comprised 56.58% (1801 bp) invariable characters, 31.32% (997 bp) phylogenetically informative characters and 12.10% (385 bp) uninformative variable characters. Each of single locus has the following invariable characters (ITS = 414, TEF = 186, TUB = 523, CAL = 310, and HIS = 352), phylogenetically informative characters (ITS = 123, TEF = 230, TUB = 263, CAL = 238, and HIS = 143) and uninformative variable characters (ITS = 108, TEF = 56, TUB = 107, CAL = 69, and HIS = 45). A comparison of alignment properties in parsimony analyses of gene/loci and nucleotide substitution models used in phylogenetic analyses are provided in Table 2. BI tree constructed with combined five-loci data was presented with annotations for isolate number, plant host, and locality. MP tree was similar to the BI tree, therefore only BI tree was shown. D. citri was dominant species and occurred on citrus hosts in countries including China, Japan, Korea, New Zealand, Portugal, and USA. D. citriasiana and D. discoidispora were found on citrus plants only. However, D. eres, D. sojae, and D. unshiuensis were found on host plants from multiple genera. Seven isolates obtained in this study clustered in the same group with three isolates from previously known as D. infertilis including ex-type strain (CBS 230.52) and several isolates known as D. citri, this group should be the D. infertilis (Figure 3, Figures S1 and S2). Based on the similar phylogenetic analysis, all of the 140 isolates were identified (Figure S3). Results showed that D. citri was the predominant species which accounted for 44.3%, following the species of D. eres, D. unshiuensis, D. sojae, D. discoidispora and D. citriasiana, which accounted for 11.4%, 10%, 9.3%, 6.4%, and 3.6%, respectively. There were still 15% isolates that could not be identified to the species level (Supplementary Figure S3).

2.4. Morphological Characterization of D. citri

For Diaporthe species, morphological factors such as colony appearance on different media, conidiomata, conidia shape and size are important to identify and understand a specific species. Therefore, morphological observation was performed on different media. Colonies on PDA grew slowly with 0.3–1.0 mm/day in the dark at 25 °C, they were white, flat or effuse alternate to low convex; reverse mottled buff with irregular dark patches. On CMA and OMA media, sparse to moderate mycelia covered the entire plate after 10 days with numerous scattered pale mouse grey patches. Conidiomata sporulating on PDA were scattered or aggregated, black-deeply embedded in medium, becoming erumpent at maturity. Conidiomata were sub-globose and/or variable in shape and up to 200 μm diam in size with an elongated black neck. Conidial mass was initially hyaline to yellowish, becoming white to cream conidial droplets exuding from central ostioles after 25 days in light at 25 °C. Alpha conidia were aseptate, hyaline, smooth, ovate to ellipsoidal, mostly bi-guttulate, apex bluntly rounded, base sub-truncate, (5.7−) 7–9.2 (−10.1) × (1.7−) 2.1–3.1 (−3.6) μm ( x ¯ ± SD = 8.1 ± 1.1 × 2.6 ± 0.5). Beta conidia were aseptate, flexuous, flexible to slightly curved or hamate, smooth, hyaline, apex acutely rounded, base truncate, (11.7−) 15.7–27.7 (−33) × (0.4−) 0.6–1.2 (−1.6) μm ( x ¯ ± SD = 21.7 ± 6 × 0.9 ± 0.3). Gamma conidia were not observed (Figure 4).

2.5. Specificity and Sensitivity of PCR Method for Detection of D. citri

As mentioned above, sequences of five loci were obtained for phylogenetic analysis (Supplementary Figures S1 and S2), among them, TUB showed the best capability of D. citri distinguishing different from other Diaporthe species (Figure 5). Therefore, TUB gene was chosen for designing the species-specific primers by matching the forward primer in the varied region and the reverse primer in the conserved region of TUB gene (Figure 5). As the PCR reaction is performed with the commercial PCR amplification mixture, only the annealing temperature is optimized. Results showed that consistent amplification could be obtained at the annealing temperature from 50 to 60 °C for the species-specific primer pair as shown in Figure 6. Thus, 55 °C was considered as the optimized annealing temperature and used in the following experiments. For the specificity evaluation, the specific primer set TUBDcitri-F1/TUBD-R1 amplified a single product of 217 bp only from the D. citri isolates. The 217 bp amplicon was not observed in other five Diaporthe species (D. citriasiana, D. discoidispora, D. eres, D. sojae, and D. unshiuensis), indicating that the method has good specificity for D. citri (Figure 7A and Figure S4). The sensitivity was evaluated by using a serial dilution of genomic DNA (gDNA) as templates, results showed that it could amplified the 217 bp fragment from 10 pg of isolate NFHF-8-4 gDNA in 20 μL reaction mixture, indicating very high sensitivity (Figure 7B).

3. Discussion

D. citri, a phytopathogenic fungus causing melanose disease has become one of the most devastating citrus pathogens. According to data recorded, the geographic distribution of D. citri has been documented in Asia (China, Japan, and Korea), New Zealand, Portugal (Azores Islands), and USA. Even without the DNA sequence database, D. citri has also been reported in many other countries, e.g., Brazil, Cambodia, Cuba, Cook Islands, Cote d’Ivoire, Dominican, Haiti, Panama, Puerto Rico, Trinidad and Tobago, Venezuela, Mexico, Fiji, Mauritius, Philippines, Thailand, Myanmar, Niue, Samoa, Tonga, Zimbabwe, and Cyprus. In China, D. citri has been documented in several citrus plantations, e.g., Chongqing, Guangxi, Hunan, Jiangxi, Zhejiang, Hong Kong, and Taiwan [21,47,48,49,50].
For Diaporthe species identification, Santos, et al. [38] suggested the combined multi-locus sequences of ITS, TEF, TUB, CAL, and HIS, which were highly effective for resolving boundaries of Diaporthe species. Also, a single locus TEF gave better delimitation for Diaporthe species in phylogeny analysis [38]. Nevertheless, more accurate identification could be obtained based on the combined sequences from TUB, CAL, HIS, and ITS loci [38]. It has been reported that several Diaporthe species could be confusing, and conflicting results could be observed if only ITS region was used to construct phylogenetic tree [6,39,51]. The D. citri strains were isolated from citrus in China and USA, and pathogenicity test confirmed that D. citri was the causal agent of melanose and stem-end rot of citrus plant [21,32,33]. However, one cluster named as D. citri appeared conflict demonstration with the multi-gene phylogenetic analysis [6,21]. Guarnaccia and Crous [20] analyzed Diaporthe species emerging on citrus in European countries and reconsidered that three isolates which were previously recognized as D. citri, should be the D. infertilis because they were obviously different from other clusters of D. citri based on the phylogenetic analysis. In current study, strong evidence with concatenated multi-locus sequences also showed that D. infertilis was distinct with D. citri. To date, D. infertilis has been found on C. sinensis (Suriname), Glycine max (Brazil), unknown host (Italy), Citrus limon (India), and Mikania glomerate (Brazil), respectively.
In earlier studies, methods based on PCR were developed for detecting fungal pathogens on citrus. For instance, Bonants, et al. [52] designed species-specific primers from the ITS region to detect Phyllosticta citricarpa, a black spot pathogen of orange (Citrus sinensis), and lemon (C. limon). Wang, et al. [53] also designed species-specific primer pair from ITS to detect black spot disease of pumelo (C. maxima). Also, simple PCR was developed to distinguish Phyllosticta citricarpa from Phyllosticta mangiferae by directly using fungal mycelia on PDA or fruit lesions [54,55]. Real-time PCR with TaqMan probe was developed for routine quarantine of citrus black spot disease [56]. Similarly, real-time PCR based on ITS was used to distinguish Phyllosticta citricarpa from Phyllosticta citriasiana, both species could not be distinguished from each other based on morphological characterization [57].
SCAR-marker was developed to detect Pseudofabraes citricarpa, a fungus causing target spot on Satsuma mandarin (Citrus unshiu) and kumquat (Fortunella margarita) in China [58]. Similarly, SACR-marker derived from random amplified polymorphic DNA (RAPD) was used to simultaneously detect Phytophthora nicotianae and Candidatus Liberibacter asiaticus, the causal agents of citrus roots rot and greening [59]. Pereira, et al. [60] developed a multiplex real-time PCR assay to detect Colletotrichum abscissum and Colletotrichum gloeosporioides, the causal agents of citrus post-bloom fruit drop.
Latent infected D. citri may be the initial source of inoculum of melanose, and a rapid and sensitive diagnosis for detection of this pathogen is currently limited. In previously study, a conserved ITS region was used to design a molecular detection on D. longicolla, D. azadirachtae, and D. sclerotioides [42,43,44,45]. Several studies reported that molecular detection of Diaporthe species from conserved ITS region was weak and poor, thus could not distinguish the Diaporthe complex species [38]. A specific gene TEF was used to detect D. azadirachtae [46]. However, the molecular tool for D. citri detection has not been published. In present study, the novel species-specific PCR assay for detection of D. citri was established. This tool can be useful for routine diagnostic work and would be useful to monitor the prevalence of the D. citri.

4. Materials and Methods

4.1. Sample Collection and Fungal Isolation

Leaf, fruit, and twig tissues with melanose symptomatic sweet orange (Citrus sinensis) and nanfengmiju mandarin (C. reticulata cv. Nanfengmiju) were collected from Ganzhou city (Xinfeng, Nankang) and Fuzhou city (Nanfeng) Jiangxi Province, China. The samples were collected and took back to Key Lab of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University, Wuhan, China. Photos of the diseased samples were captured by using Cannon 600D digital camera (Cannon Inc., Tokyo, Japan). Isolates of Diaporthe-like species were isolated from two citrus cultivars, sweet orange and nanfengmiju mandarin showing melanose symptoms. Pure isolates were obtained by cutting off the hyphal tips growing from surface-sterilized diseased material. For fungal isolation, each sample of symptomatic tissues was cut into small pieces (5 × 5 mm) with the junction of diseased and healthy tissues. Small pieces of plant tissues were soaked in 75% ethanol solution for 1 min, surface disinfected in 1% sodium hypochlorite solution (NaClO) for 1 min, then rinsed three times with double sterilized water, and dried on sterile tissue paper. Dried small pieces of plant tissues were placed onto potato dextrose agar medium (PDA) amended with 100 µg/mL streptomycin and 100 µg/mL ampicillin (PDA-SA), then incubated for 2–5 days at 25 °C. After that, mycelium tips growing from small pieces of plant tissues were harvested and transferred to Petri dishes with fresh PDA medium for sporulation at 25 °C for 20–30 days. Monosporic isolation was performed according to the method by Goh [61] and Yin, et al. [62]. Pure fungal isolates were kept at 4 °C whenever they are used.

4.2. Geographic Distribution of D. citri

Extensive information of D. citri with geographic distribution and host-fungus relationships were investigated in the Systematic Mycology and Microbiology Laboratory, ARS, USDA (SMML database: https://nt.ars-grin.gov/fungaldatabases/ [63].

4.3. DNA Extraction from Fungal Mycelia

For genomic DNAs (gDNAs) extraction, fresh fungal mycelia were harvested from 7-day old culture on PDA [21]. A hyphal plug about 1.5 square centimeters was cut off and placed into a 2 mL micro-tube with 200 mg of sterile stainless-steel beads (1.6 mm in diameter). Next, 500 µL gDNAs extraction lysis buffer (Lysis buffer stock 200 mL: 14.91 g of KCl, 20 mL of 1 M Tris-HCl (pH 8.0), 0.74 g of EDTA-Na2·2H2O (pH 8.0), adjust with sterile water to 200 mL) was added into the micro-tube. The micro-tube was vigorously homogenized at maximum speed for 10 min on the Bullet Blender® Storm 24 (BBY24M; Next Advance, Inc., New York, USA), then centrifuged at 12,500× g for 6 min. Three hundred microliters of gDNAs supernatant were transferred to a new 1.5 mL micro-tube and 300 µL isopropyl alcohol was added. Then, the mixture was gently mixed at room temperature. The solution was centrifuged at 12,500× g for 6 min. After discarded the supernatant, gDNAs pellets were rinsed twice with 300 µL of 70% ethanol, and air dried. At last, 30 µL of sterile water (ddH2O) was added to dissolve gDNAs pellets following Chi’s protocol [64]. The gDNAs quality and quantity were measured via UV absorption at wavelength 260 and 280 nm by Thermo Scientific™ NanoDrop 2000 (Thermo Fisher Scientific Inc., Massachusetts, USA). The gDNAs was either used or stored at −20 °C until further processing.

4.4. Sequencing of PCR Products

Fragments of nuclear ribosomal internal transcribed spacer regions (ITS), translation elongation factor 1-α gene (TEF), beta-tubulin gene (TUB), calmodulin gene (CAL), and histone-3 gene (HIS) were amplified by polymerase chain reaction (PCR) with primers described in Table 3. Twenty microliter PCR reaction volume including 1 μL gDNA, 0.8 μL (10 μM) of each primer, 7.6 μL ddH2O and 10 μL 2 × Hieff® PCR Master Mix (Yeasen Biotech Co., Ltd., Shanghai, China), in a T100TM Thermal Cycler (Bio-Rad, California, USA). The PCR reaction was performed following conditions: 95 °C for 3 min, followed by 35 cycles at 95 °C for 30 s, annealing for 50 s at different temperature for different loci, 72 °C for 2 min, and 72 °C for 5 min. The PCR products were applied to electrophoresis in 1% agarose gel and visualized by staining the gel with GoldenViewTM dye (Aidlab Biotechnologies Co., Ltd., Beijing, China). The Sanger sequencing of PCR products was performed on ABI 3730xl DNA Sequencer at Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. (Wuhan, China).

4.5. Phylogenetic Analyses of Diaporthe Species

Phylogenetic analysis was carried out by using sequences obtained in current study and those downloaded from NCBI’s GenBank (www.ncbi.nlm.nih.gov). Diaporthella corylina (CBS 121124) was selected as an outgroup (Table 4). All unique DNA sequences were consensus and edited with DNASTAR Lasergene Core Suite software programme (SeqMan v.7.1.0; DNASTAR Inc., Wisconsin, USA). Sequences combined different loci were aligned using Clustal W program with supplement software package in BioEdit v.7.2.5 [69]. Maximum parsimony (MP) analysis was done by using PAUP (Phylogenetic Analysis Using Parsimony, v.4.0b10) [70]. The goodness of fit values including tree length (TL), consistency index (CI), retention index (RI), rescaled consistency index (RC), and homoplasy index (HI) were calculated for parsimony and the bootstrap analyses [71]. The heuristic search function was used with 1000 random stepwise addition replicates, with tree bisection and reconnection (TBR) branch-swapping algorithm, with all characters weighted equally weighted and alignment gaps treated as missing data. Posterior probabilities (PP) were determined using Markov chain Monte Carlo (MCMC) sampling for Bayesian inference (BI) analysis in MrBayes v.3.2.2 [72]. MrModeltest v.2.3 [73] was used to perform statistical selection of the best-fit model of nucleotide substitution with corrected Akaike information criterion (AIC). BI analyses were launched with six simultaneous Markov chains which were run for 105 generations, and trees were sampled every 100th generation (resulting in 10,000 total trees). The calculation of BI analyses was stopped when the average standard deviation of split frequencies fell below 0.01. The consensus trees and posterior probabilities (PP) values were calculated after discarding the first 2000 resulted trees of the analyses as burn-in phase. Finally, above 8000 trees were summarized to calculate the PP in the majority rule consensus tree. Phylogenetic trees were visualized and annotated in FigTree v.1.4.2 [74]. The concatenated alignments and phylogenetic trees were deposited in TreeBASE (study no. S25607), new sequences obtained in this study were submitted to NCBI’s GenBank nucleotide database.

4.6. Morphology and Culture Characteristics of D. citri

Isolates on PDA plates were incubated at 25 °C for 30 days under near-ultraviolet (UV) light (12 h light/12 h dark). The growth rate of mycelium was measured in five duplicates. Colony color on PDA, Corn meal agar (CMA), and Oatmeal agar (OMA) media incubated at 25 °C near UV light with 12 h, was investigated according to the method of Rayner [84]. The morphology imagines were taken using Canon 600D digital camera (Canon Inc., Tokyo, Japan) after 10 days of incubation. Conidiomata and conidia were observed under the OLYMPUS SZX16 stereomicroscope (Olympus Corporation, Tokyo, Japan), conidial length/wide ratio of 30 conidia was measured with a stage micrometer under a Motic BA200 light microscope (Motic China Group Co., Ltd., Nanjing, China). Alpha and beta conidia were measured for calculating means ( x ¯ ) and standard deviations (SD). The conidia ranges were shown as (min−) x ¯ − SD − x ¯ + SD (−max) μm ( x ¯ ± SD). Conidia digital images were captured using Nikon Eclipse 80i compound light microscope imaging system (Nikon Corporation, Tokyo, Japan).

4.7. Primer Design and Development of the Molecular Tool to Detect D. citri

A highly varied region in TUB gene was selected as the target for developing molecular tool based on PCR to specifically detect D. citri from other Diaporthe species. Partial TUB gene of D. citri was retrieved from NCBI GenBank database (accession no. MN894459). The obtained sequences were aligned by using Clustal W algorithm in software package BioEdit v.7.2.5 [69]. The primers were designed by analyzing hairpin-dimer potential, length of the desired amplicon, %GC content, and melting temperatures (Ta) in Primer premier 6.0 software (Premier Biosoft International, California, USA). The primers were synthesized by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. (Wuhan, China). All the primer sequences used in this study are listed in Table 3.
Firstly, the annealing temperature was optimized in a gradient PCR in which the annealing temperatures were set from 50 to 65 °C. For specificity evaluation, gDNAs of D. citri (NFHF-8-4), D. citriasiana (XFAL-1-1), D. discoidispora (NKDL-1-2), D. eres (NFIF-1-1), D. sojae (NFGL-1-5), and D. unshiuensis (NFIF-1-6) were used, because these species are the closely related Diaporthe species in the phylogenetic analysis. The PCR reaction was performed in a final volume of 20 μL with the following components: 10 μL 2 × Hieff® PCR Master Mix (Yeasen Biotech Co., Ltd., Shanghai, China), 7.6 μL ddH2O, 0.8 μL (10 μM) of each species-specific primer (TUBDcitri-F1/TUBD-R1), and 1 μL gDNA (10 ng). The T100TM Thermal Cycler (Bio-Rad, USA) was programmed for conditions as 95 °C for 3 min, followed by 35 cycles at 95 °C for 30 s, annealing temperature (Ta) of 55 °C for 2 min, and 72 °C for 5 min. Finally, 5 μL products were used to electrophoresis on 2% agarose gel and visualized by staining the gel with GoldenViewTM dye (Aidlab Biotechnologies Co., Ltd., Beijing, China), along with a 50 bp ladder as molecular marker (GL DNA Marker 500; Accurate Biotechnology (Hunan) Co., Ltd., Hunan, China) and 100 bp ladder (DNA 2K plus marker; TransGen Biotech Co., Ltd., Beijing, China). Similar test was also applied for the phylogenetically analyzed 38 isolates. For sensitivity evaluation, a serial of 10-fold dilutions of gDNA from D. citri isolate NFHF-8-4 ranging from 102 to 10−4 ng in 20 μL reaction mixture were used under the conditions described above.

5. Conclusions

In current study, it has been documented that Diaporthe species could cause devastating citrus diseases and D. citri was the causal agent of the citrus melanose disease. Based on the phylogenetic analysis with five multi-locus sequences, Diaporthe species boundaries could be clearly delimitated. We also designed species-specific primers from TUB gene to develop PCR method for detecting D. citri. The PCR-based method showed high specificity and sensitivity, that could be applied for detection of D. citri efficiently in practice. In the future, efficient PCR should be developed with citrus tissues infected by D. citri and multiple PCR which can distinguish different Diaporthe species should be developed for the phytosanitary assay in plant quarantine routine work.

Supplementary Materials

The following are available online at https://www.mdpi.com/2223-7747/9/3/329/s1, Table S1: Checklist of Diaporthe citri and D. infertilis associated with details citrus host and their allied genera, locality and their reference(s), Figure S1: Phylogenetic trees of Diaporthe spp. by Bayesian inference (BI) analysis based on combined data set and individual locus (ITS, TUB, TEF, CAL, and HIS, respectively). Ex-type, ex-isotype, and ex-epitype strains are indicated in bold. The species Diaporthella corylina (CBS 121124) was selected as an outgroup, Figure S2: Phylogenetic tree of Diaporthe spp. generated by Maximum Parsimony (MP) analysis based on combined data set and individual locus (ITS, TUB, TEF, CAL, and HIS, respectively). Ex-type, ex-isotype, and ex-epitype strains are indicated in bold. The species Diaporthella corylina (CBS 121124) was selected as an outgroup, Figure S3: The prevalence of Diaporthe species on citrus in Jiangxi Province, China based on phylogenetic identification. Number (%) indicate the number of obtained isolates of certain species and the percentage among the total 140 isolates. Figure S4: Species-specific 217 bp TUB gene amplified by the primer pair TUBDcitri-F1/TUBD-R1 was shown with 2% gel electrophoresis. Thirty-eight representatives that were identified based on phylogenetic analysis were used to confirm the specificity of PCR approach. The numbers of D. citri, D. citriasiana, D. discoidispora, D. eres, D. sojae, and D. unshiuensis isolates were 10, 3, 5, 10, 5, and 5, respectively. Lane CK is the double sterile water (ddH2O) as negative control and lane M, 100 bp ladder.

Author Contributions

Conceptualization, C.C., Y.L. and C.-X.L.; Validation, C.C., X.-Y.L., Y.L. and C.-X.L.; Formal analysis, C.C. and X.-Y.L.; Investigation, C.C., X.-Y.L., J.-B.L. and B.X.; Resources, J.-B.L. and B.X.; Data curation, C.C., X.-Y.L., Y.L. and C.-X.L.; Writing, C.C. and C.-X.L.; Funding acquisition, Y.L. and C.-X.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key Research and Development Program of China (No. 2017YFD020200103).

Acknowledgments

We gratefully thank Mingkhuan Doilom (Key Laboratory for Plant Diversity and Biogeography of East Asia, Kunming Institute of Botany, Chinese Academy of Sciences, China) and Sinang Hongsanan (Shenzhen Key Laboratory of Microbial Genetic Engineering, Shenzhen University, China) for technical assistance and valuable advice.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Wu, G.A.; Terol, J.; Ibanez, V.; López-García, A.; Pérez-Román, E.; Borredá, C.; Domingo, C.; Tadeo, F.R.; Carbonell-Caballero, J.; Alonso, R.; et al. Genomics of the origin and evolution of Citrus. Nature 2018, 554, 311–330. [Google Scholar] [CrossRef] [Green Version]
  2. FAO. Citrus fruit—Fresh and processed statistical bulletin 2016; Food and Agriculture Organization of the United Nations: Rome, Italy, 2017. [Google Scholar]
  3. Deng, X.X.; Peng, C.J.; Chen, Z.S.; Deng, Z.N.; Xu, J.G.; Li, J. Citrus Varieties in China; China Agriculture Press: Beijing, China, 2008. [Google Scholar]
  4. Boddy, L.; Griffth, G.S. Role of endophytes and latent invasion in the development of decay communities in sapwood of angiospermous trees. Sydowia 1989, 41, 41–73. [Google Scholar]
  5. Carroll, G.C. The Biology of Endophytism in Plants with Particular Reference to Woody Perennials; Cambridge University Press: Cambridge, UK, 1986. [Google Scholar]
  6. Gomes, R.R.; Glienke, C.; Videira, S.I.R.; Lombard, L.; Groenewald, J.Z.; Crous, P.W. Diaporthe: A genus of endophytic, saprobic and plant pathogenic fungi. Persoonia 2013, 31, 1–41. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Marin-Felix, Y.; Hernández-Restrepo, M.; Wingfield, M.J.; Akulov, A.; Carnegie, A.J.; Cheewangkoon, R.; Gramaje, D.; Groenewald, J.Z.; Guarnaccia, V.; Halleen, F.; et al. Genera of phytopathogenic fungi: GOPHY 2. Stud. Mycol. 2019, 92, 47–133. [Google Scholar] [CrossRef] [PubMed]
  8. Suryanarayanan, T.S.; Devarajan, P.T.; Girivasan, K.P.; Govindarajulu, M.B.; Kumaresan, V.; Murali, T.S.; Rajamani, T.; Thirunavukkarasu, N.; Venkatesan, G. The host range of multi-host endophytic fungi. Curr. Sci. 2018, 115, 1963–1969. [Google Scholar] [CrossRef]
  9. Guarnaccia, V.; Vitale, A.; Cirvilleri, G.; Aiello, D.; Susca, A.; Epifani, F.; Perrone, G.; Polizzi, G. Characterisation and pathogenicity of fungal species associated with branch cankers and stem-end rot of avocado in Italy. Eur. J. Plant Pathol. 2016, 146, 963–976. [Google Scholar] [CrossRef]
  10. Mostert, L.; Crous, P.W.; Kang, J.C.; Phillips, A.J.L. Species of Phomopsis and a Libertella sp. occurring on grapevines with specific reference to South Africa: Morphological, cultural, molecular and pathological characterization. Mycologia 2001, 93, 146–167. [Google Scholar] [CrossRef]
  11. Rehner, S.A.; Uecker, F.A. Nuclear ribosomal internal transcribed spacer phylogeny and host diversity in the coelomycete Phomopsis. Can. J. Bot. 1994, 72, 1666–1674. [Google Scholar] [CrossRef]
  12. Santos, J.M.; Vrandečić, K.; Ćosić, J.; Duvnjak, T.; Phillips, A.J.L. Resolving the Diaporthe species occurring on soybean in Croatia. Persoonia 2011, 27, 9–19. [Google Scholar] [CrossRef] [Green Version]
  13. Thompson, S.M.; Tan, Y.P.; Young, A.J.; Neate, S.M.; Aitken, E.A.B.; Shivas, R.G. Stem cankers on sunflower (Helianthus annuus) in Australia reveal a complex of pathogenic Diaporthe (Phomopsis) species. Persoonia 2011, 27, 80–89. [Google Scholar] [CrossRef] [Green Version]
  14. Cai, L.; Giraud, T.; Zhang, N.; Begerow, D.; Cai, G.H.; Shivas, R.G. The evolution of species concepts and species recognition criteria in plant pathogenic fungi. Fungal Divers. 2011, 50, 121–133. [Google Scholar] [CrossRef]
  15. Duan, W.J.; Yan, J.; Liu, F.; Cai, L.; Zhu, S.F. The list of Chinese quarantine fungi is in need of revision and renewal (in Chinese). Mycosystema 2015, 34, 942–960. [Google Scholar]
  16. Rossman, A.Y.; Palm-Hernández, M.E. Systematics of plant pathogenic fungi: Why it matters. Plant Dis. 2008, 92, 1376–1386. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Shivas, R.G.; Cai, L. Cryptic fungal species unmasked. Microbiol. Aust. 2012, 33, 36–37. [Google Scholar]
  18. Timmer, L.W.; Garnsey, S.M.; Graham, J.H. Scab Diseases; revised edition: 31–32 ed.; American Phytopathological Society Press: St. Paul, MN, USA, 2000; p. 92. [Google Scholar]
  19. Whiteside, J.O.; Timmer, L.W. Citrus Diseases: General Concepts; revised edition: 3–4 ed.; American Phytopathological Society: St. Paul, MN, USA, 2000. [Google Scholar]
  20. Guarnaccia, V.; Crous, P.W. Emerging citrus diseases in Europe caused by species of Diaporthe. IMA Fungus 2017, 8, 317–334. [Google Scholar] [CrossRef] [Green Version]
  21. Huang, F.; Hou, X.; Dewdney, M.M.; Fu, Y.S.; Chen, G.Q.; Hyde, K.D.; Li, H.Y. Diaporthe species occurring on citrus in China. Fungal Divers. 2013, 61, 237–250. [Google Scholar] [CrossRef]
  22. Kucharek, T.; Whiteside, J.; Brown, E. Melanose and Stem End Rot of Citrus; Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences, University of Florida: Gainesville, FL, USA, 1983. [Google Scholar]
  23. Mondal, S.N.; Vicent, A.; Reis, R.F.; Timmer, L.W. Saprophytic colonization of citrus twigs by Diaporthe citri and factors affecting pycnidial production and conidial survival. Plant Dis. 2007, 91, 387–392. [Google Scholar] [CrossRef] [Green Version]
  24. Udayanga, D.; Castlebury, L.A.; Rossman, A.Y.; Hyde, K.D. Species limits in Diaporthe: Molecular re-assessment of D. citri, D. cytosporella, D. foeniculina and D. rudis. Persoonia 2014, 32, 83–101. [Google Scholar] [CrossRef] [Green Version]
  25. Swingle, W.T.; Webber, H.J. The principal disease of citrus fruits in Florida. USDA Div. Veg. Physiol. Pathol. Bull. 1896, 8, 9–14. [Google Scholar]
  26. Fawcett, H.S. The cause of stem-end rot of citrus fruits (Phomopsis citri n. sp.). Phytopathology 1912, 2, 109–113. [Google Scholar]
  27. Floyd, B.F.; Stevens, H.E. Melanose and stem-end rot. Fla. Agr. Expt. Sta. Bull. 1912, 111, 1–16. [Google Scholar]
  28. Rehm, H. Ascomycetes philippinenses VI. Leafl. Philipp. Bot. 1914, 6, 2258–2281. [Google Scholar]
  29. Horne, W.T. A Phomopsis in grape fruit from the isle of Pines W. I., with notes on Diplodia natalensis. Phytopathology 1922, 12, 414–418. [Google Scholar]
  30. Nitschke, T.R.J. Pyrenomycetes germanici. In Die kernpilze Deutschlands Bearbeitet Von Dr. Th. Nitschke; Eduard Trewendt: Breslau, Germany, 1870; Volume 2, pp. 161–320. [Google Scholar]
  31. Fawcett, H.S. A Phomopsis of citrus in California. Phytopathology 1922, 12, 107. [Google Scholar]
  32. Bach, W.J.; Wolf, F.A. The isolation of the fungus that causes citrus melanose and the pathological anatomy of the host. J. Agric. Res. 1928, 37, 243–252. [Google Scholar]
  33. Ruehle, G.D.; Kuntz, W.A. Melanose of Citrus and Its Commercial Control; Florida Agricultural Experiment Station Bulletin, University of Florida: Gainesville, FL, USA, 1940. [Google Scholar]
  34. Castlebury, L. The Diaporthe vaccinii complex of fruit pathogens. Inoculum 2005, 56, 12. [Google Scholar]
  35. Santos, J.M.; Correia, V.G.; Phillips, A.J.L.; Spatafora, J.W. Primers for mating-type diagnosis in Diaporthe and Phomopsis: Their use in teleomorph induction in vitro and biological species definition. Fungal Biol. 2010, 114, 255–270. [Google Scholar] [CrossRef]
  36. Santos, J.M.; Phillips, A.J.L. Resolving the complex of Diaporthe (Phomopsis) species occurring on Foeniculum vulgare in Portugal. Fungal Divers. 2009, 34, 111–125. [Google Scholar]
  37. Guarnaccia, V.; Groenewald, J.Z.; Woodhall, J.; Armengol, J.; Cinelli, T.; Eichmeier, A.; Ezra, D.; Fontaine, F.; Gramaje, D.; Gutierrez-Aguirregabiria, A.; et al. Diaporthe diversity and pathogenicity revealed from a broad survey of grapevine diseases in Europe. Persoonia 2018, 40, 135–153. [Google Scholar] [CrossRef] [Green Version]
  38. Santos, L.; Alves, A.; Alves, R. Evaluating multi-locus phylogenies for species boundaries determination in the genus Diaporthe. PeerJ 2017, 5, 1–26. [Google Scholar] [CrossRef] [Green Version]
  39. Udayanga, D.; Castlebury, L.A.; Rossman, A.Y.; Chukeatirote, E.; Hyde, K.D. Insights into the genus diaporthe: Phylogenetic species delimitation in the D. eres species complex. Fungal Divers. 2014, 67, 203–229. [Google Scholar] [CrossRef] [Green Version]
  40. Yang, Q.; Fan, X.L.; Guarnaccia, V.; Tian, C.M. High diversity of Diaporthe species associated with dieback diseases in China, with twelve new species described. MycoKeys 2018, 39, 97–149. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  41. Hyde, K.D.; Nilsson, R.H.; Alias, S.A.; Ariyawansa, H.A.; Blair, J.E.; Cai, L.; de Cock, A.W.A.M.; Dissanayake, A.J.; Glockling, S.L.; Goonasekara, I.D.; et al. One stop shop: Backbones trees for important phytopathogenic genera: I (2014). Fungal Divers. 2014, 67, 21–125. [Google Scholar] [CrossRef] [Green Version]
  42. Zhang, A.W.; Hartman, G.L.; Riccioni, L.; Chen, W.D.; Ma, R.Z.; Pedersen, W.L. Using PCR to distinguish Diaporthe phaseolorum and Phomopsis longicolla from other soybean fungal pathogens and to detect them in soybean tissues. Plant Dis. 1997, 81, 1143–1149. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Prasad, M.N.N.; Bhat, S.S.; Raj, A.P.C.; Janardhana, G.R. Molecular detection of Phomopsis azadirachtae, the causative agent of dieback disease of neem by polymerase chain reaction. Curr. Sci. 2006, 91, 158–159. [Google Scholar]
  44. Vedashree, S.; Sateesh, M.K.; Chowdappa, P.; Nirmalkumar, B.J. Species-specific PCR-based assay for identification and detection of Phomopsis (Diaporthe) azadirachtae causing die-back disease in Azadirachta indica. J. Phytopathol. 2015, 163, 818–828. [Google Scholar] [CrossRef]
  45. Shishido, M.; Sato, K.; Yoshida, N.; Tsukui, R.; Usami, T. PCR-based assays to detect and quantify Phomopsis sclerotioides in plants and soil. J. Gen. Plant Pathol. 2010, 76, 21–30. [Google Scholar] [CrossRef]
  46. Shirahatti, P.; Ramu, R.; Purushothama, C.R.A.; Prasad, M.N.N. Development of a simple and reliable species-species detection of Phomopsis azadirachtae, using the translation elongation factor 1-alpha gene. Eur. J. Plant Pathol. 2015, 141, 769–778. [Google Scholar] [CrossRef]
  47. Anonymous. List of Plant Diseases in Taiwan; Plant Protection Soc: Taichung, China, 1979; p. 404. [Google Scholar]
  48. Huang, F.; Udayanga, D.; Wang, X.H.; Hou, X.; Mei, X.F.; Fu, Y.S.; Hyde, K.D.; Li, H.Y. Endophytic Diaporthe associated with citrus: A phylogenetic reassessment with seven new species from China. Fungal Biol. 2015, 119, 331–347. [Google Scholar] [CrossRef]
  49. Lu, B.S.; Hyde, K.D.; Ho, W.H.; Tsui, K.M.; Taylor, J.E.; Wong, K.M.; Yanna, Z.D.; Zhou, D.Q. Checklist of Hong Kong Fungi; Fungal Diversity Press: Hong Kong, China, 2000; p. 207. [Google Scholar]
  50. Zhuang, W.Y. Higher Fungi of Tropical China; Mycotaxon, Ltd.: Ithaca, NY, USA, 2001; p. 485. [Google Scholar]
  51. Udayanga, D.; Castlebury, L.A.; Rossman, A.Y.; Chukeatirote, E.; Hyde, K.D. The Diaporthe sojae species complex: Phylogenetic re-assessment of pathogens associated with soybean, cucurbits and other field crops. Fungal Biol. 2015, 119, 383–407. [Google Scholar] [CrossRef]
  52. Bonants, P.J.M.; Carroll, G.C.; de Weerdt, M.; van Brouwershaven, I.R.; Baayen, R.P. Development and validation of a PCR-based detection method for pathogenic isolates of the citrus black spot fungus, Guignardia citricarpa. Eur. J. Plant Pathol. 2003, 109, 503–513. [Google Scholar] [CrossRef]
  53. Wang, X.H.; Chen, G.Q.; Huang, F.; Zhang, J.Z.; Hyde, K.D.; Li, H.Y. Phyllosticta species associated with citrus diseases in China. Fungal Divers. 2012, 52, 209–224. [Google Scholar] [CrossRef]
  54. Meyer, L.; Sanders, G.M.; Jacobs, R.; Korsten, L. A one-day sensitive method to detect and distinguish between the citrus black spot pathogen Guignardia citricarpa and the endophyte Guignardia mangiferae. Plant Dis. 2006, 90, 97–101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Peres, N.A.; Harakava, R.; Carroll, G.C.; Adaskaveg, J.E.; Timmer, L.W. Comparison of molecular procedures for detection and identification of Guignardia citricarpa and G. mangiferae. Plant Dis. 2007, 91, 525–531. [Google Scholar] [CrossRef]
  56. van Gent-Peizer, M.P.E.; van Brouwershaven, I.R.; Kox, L.F.F.; Bonants, P.J.M. A Taqman PCR method for routine diagnosis of the quarantine fungus Guignardia citricarpa on citrus fruit. J. Phytopathol. 2007, 155, 357–363. [Google Scholar] [CrossRef]
  57. Schirmacher, A.M.; Tomlinson, J.A.; Barnes, A.V.; Barton, V.C. Species-specific real-timle PCR for diagnosis of Phyllosticta citricarpa on citrus species. Bull. OEPP/EPPO Bull. 2019, 49, 306–313. [Google Scholar] [CrossRef]
  58. Yang, Y.H.; Hu, J.H.; Chen, F.J.; Ding, D.K.; Zhou, C.Y. Development of a SCAR marker-based diagnostic method for the detection of the citrus target spot pathogen Pseudofabraea citricarpa. Biomed. Res. Int. 2018, 2018, 7128903. [Google Scholar] [CrossRef] [Green Version]
  59. Das, A.K.; Nerkar, S.; Gawande, N.; Thakre, N.; Kumar, A. Scar marker for phytophthora nicotianae and a multiplex PCR assay for simultaneous detection of P. nicotianae and Candidatus liberibacter asiaticus in citrus. J. Appl. Microbiol. 2019, 127, 1172–1183. [Google Scholar] [CrossRef]
  60. Pereira, W.V.; Bertolini, E.; Cambra, M.; Junior, N.S.M. Multiplex real-time PCR for detection and quantification of Colletotrichum abscissum and C. gloeosporioides on Citrus leaves. Eur. J. Plant Pathol. 2019, 155, 1–13. [Google Scholar] [CrossRef]
  61. Goh, T.K. Single-spore isolation using a hand-made glass needle. Fungal Divers. 1999, 2, 47–63. [Google Scholar]
  62. Yin, L.F.; Chen, S.N.; Chen, G.K.; Schnabel, G.; Du, S.F.; Chen, C.; Li, G.Q.; Luo, C.X. Identification and characterization of three Monilinia species from plum in China. Plant Dis. 2015, 99, 1775–1783. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  63. Farr, D.F.; Rossman, A.Y. Fungal Databases; U.S. National Fungus Collections, ARS, USDA: Washington, DC, USA, 2018.
  64. Chi, M.H.; Park, S.Y.; Lee, Y.H. A quick and safe method for fungal DNA extraction. Plant Pathol. J. 2009, 25, 108–111. [Google Scholar] [CrossRef]
  65. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. [Google Scholar]
  66. Carbone, I.; Kohn, L.M. A method for desianing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
  67. Glass, N.L.; Donaldson, G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microb. 1995, 61, 1323–1330. [Google Scholar] [CrossRef] [Green Version]
  68. Crous, P.W.; Groenewald, J.Z.; Risède, J.M.; Simoneau, P.; Hywel-Jones, N.L. Calonectria species and their Cylindrocladium anamorphs: Species with clavate vesicles. Stud. Mycol. 2004, 50, 415–430. [Google Scholar] [CrossRef] [Green Version]
  69. Hall, A.T. Bioedit: A user-friendly biological sequence alignment editor and analysis program for windows 95/98/nt. Nucleic Acids Res. 1999, 41, 95–98. [Google Scholar]
  70. Swofford, D.L. PAUP* Phylogenetic Analysis Using Parsimony, (*and Other Methods); Version 4.0 b10; Sinauer Associates: Sunderland, MA, USA, 2003. [Google Scholar]
  71. Hillis, D.M.; Bull, J.J. An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Syst. Biol. 1993, 42, 182–192. [Google Scholar] [CrossRef]
  72. Ronquist, F.; Teslenko, M.; Van der Mark, P.; Ayres, D.L.; Darling, A.; Hӧhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. Mrbayes 3.2: Efficient bayesian phylogenetic tnference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [Green Version]
  73. Nylander, J.A.A. Mrmodeltest v.2. Program Distributed by the Author; Evolitionary Biology Centre, Uppsala Univeristy: Uppsala, Sweden, 2004. [Google Scholar]
  74. Rambaut, A. Figtree v.1.4.2; Institute of Evolutionary Biology, Ashworth Laboratories, University of Edinburgh: Edinburgh, UK, 2014. [Google Scholar]
  75. Lombard, L.; van Leeuwen, G.C.M.; Guarnaccia, V.; Polozzi, G.; van Rijswick, P.C.J.; Rosendahl, C.H.M.; Gabler, J.; Crous, P.W. Diaporthe species associated with Vaccinium, with specific reference to Europe. Phytopathol. Mediterr. 2014, 53, 287–299. [Google Scholar]
  76. Aguilera-Cogley, V.; Vicent, A. Etiology and distribution of foliar fungal diseases of citrus in Panama. Trop. Plant Pathol. 2019, 44, 519–532. [Google Scholar] [CrossRef]
  77. Kanematsu, S.; Kobayashi, T.; Kudo, A.; Ohtsu, Y. Conidial morphology, pathogenicity and culture characteristics of Phomopsis isolates from peach, Japanese pear and apple in Japan. Jpn. J. Phytopathol. 1999, 65, 264–273. [Google Scholar] [CrossRef]
  78. Kanematsu, S. Phylogeny of phomopsis species from fruit trees. In Direct Submission Sequence of Diaporthe citri Strian FCDC2; National Institute of Fruit Tree Science, Apple Research Station: Morioka, Japan, 2007. [Google Scholar]
  79. Gao, Y.H.; Su, Y.Y.; Sun, W.; Cai, L. Diaporthe species occurring on Lithocarpus glabra in China, with descriptions of five new species. Fungal Biol. 2015, 119, 295–309. [Google Scholar] [CrossRef] [PubMed]
  80. Mahadevakumar, S.; Yadav, V.; Tejaswini, G.S.; Sandeep, S.N.; Janardhana, G.R. First report of Phomopsis citri associated with dieback of Citrus lemon in India. Plant Dis. 2014, 98, 1281. [Google Scholar] [CrossRef] [PubMed]
  81. Polonio, J.C.; Almeida, T.T.; Garcia, D.; Mariucci, G.E.G.; Azevedo, J.L.; Rhoden, S.A.; Pamphile, J.A. Biotechnological prospecting of foliar endophytic fungi of guaco (Mikania glomerata Spreng.) with antibacterial and antagonistic activity against phytopathogens. Genet. Mol. Res. 2015, 14, 7297–7309. [Google Scholar] [CrossRef]
  82. Polonio, J.C.; Ribeiro, M.A.S.; Rhoden, S.A.; Sarragiotto, M.H.; Azevedo, J.L.; Pamphile, J.A. 3-nitropropionic acid production by the endophytic Diaporthe citri: Molecular taxonomy, chemical characterization, and quantification under ph variation. Fungal Biol. 2016, 120, 1600–1608. [Google Scholar] [CrossRef]
  83. Vasilyeva, L.N.; Rossman, A.Y.; Farr, D.F. New species of the Diaporthales from Eastern Asia and Eastern North America. Mycologia 2007, 99, 916–923. [Google Scholar] [CrossRef]
  84. Rayner, R.W. A Mycological Colour Chart; Commonwealth Mycological Institute and British Mycological Society: Kew, Surrey, UK, 1970. [Google Scholar]
Plants 09 00329 g001 550
Figure 1. Symptoms of citrus melanose caused by Diaporthe species. (A,B) Typical symptoms on young leaf of Citrus reticulata cv. Nanfengmiju. (C) Typical symptoms on old leaf of C. sinensis. (D,E) Typical symptoms on mature fruits of C. sinensis and C. reticulata cv. Nanfengmiju, respectively. (F) Typical symptoms on young fruit of C. sinensis. (G) Twig typical symptoms of C. sinensis.
Figure 1. Symptoms of citrus melanose caused by Diaporthe species. (A,B) Typical symptoms on young leaf of Citrus reticulata cv. Nanfengmiju. (C) Typical symptoms on old leaf of C. sinensis. (D,E) Typical symptoms on mature fruits of C. sinensis and C. reticulata cv. Nanfengmiju, respectively. (F) Typical symptoms on young fruit of C. sinensis. (G) Twig typical symptoms of C. sinensis.
Plants 09 00329 g001
Plants 09 00329 g002 550
Figure 2. A global geographic distribution of D. citri associated with Citrus-host plant and available on SMML database. Blue colored dots indicate the availability of the accession numbers in the NCBI database, while red colored dots indicate the non-availability.
Figure 2. A global geographic distribution of D. citri associated with Citrus-host plant and available on SMML database. Blue colored dots indicate the availability of the accession numbers in the NCBI database, while red colored dots indicate the non-availability.
Plants 09 00329 g002
Plants 09 00329 g003 550
Figure 3. The Bayesian inference consensus tree resulting from a combined data set of ITS, TUB, TEF, CAL, and HIS sequences. MP bootstrap support values (equal to or > 50%) and Bayesian posterior probability values (equal to or > 0.70) are indicated at the typological nodes. Ex-type, ex-isotype, and ex-epitype strains are indicated in bold. The tree was rooted to Diaporthella corylina (CBS 121124). Squares indicate isolates from leaves, circles indicate isolates from fruits, and triangles indicate isolates from twigs. The scale bar represents the expected number of nucleotide substitutions per site.
Figure 3. The Bayesian inference consensus tree resulting from a combined data set of ITS, TUB, TEF, CAL, and HIS sequences. MP bootstrap support values (equal to or > 50%) and Bayesian posterior probability values (equal to or > 0.70) are indicated at the typological nodes. Ex-type, ex-isotype, and ex-epitype strains are indicated in bold. The tree was rooted to Diaporthella corylina (CBS 121124). Squares indicate isolates from leaves, circles indicate isolates from fruits, and triangles indicate isolates from twigs. The scale bar represents the expected number of nucleotide substitutions per site.
Plants 09 00329 g003
Plants 09 00329 g004 550
Figure 4. The morphology and cultural characteristics of D. citri isolate NFHF-8-4. (A,B) culture on PDA medium after 7 and 30 days, respectively. (C,D) colony morphology after 30 days on CMA and OMA media, respectively. (E–H) mucilaginous drops or tendrils of conidia on PDA. (I,J) alpha conidia. (K) alpha- and beta conidia. Scale bar, E–H = 200 μm; I–K = 25 μm.
Figure 4. The morphology and cultural characteristics of D. citri isolate NFHF-8-4. (A,B) culture on PDA medium after 7 and 30 days, respectively. (C,D) colony morphology after 30 days on CMA and OMA media, respectively. (E–H) mucilaginous drops or tendrils of conidia on PDA. (I,J) alpha conidia. (K) alpha- and beta conidia. Scale bar, E–H = 200 μm; I–K = 25 μm.
Plants 09 00329 g004
Plants 09 00329 g005 550
Figure 5. A novel primer pair TUBDcitri-F1 and TUBD-R1 was designed based on the alignment of the partial TUB gene (from 5´ to 3´) of Diaporthe species including D. citri, D. citriasiana, D. discoidispora, D. eres, D. infertilis, D. sojae, and D. unshiuensis. Dashes (−) and dots (.) indicate the gaps and identical nucleotides in the sequences, respectively.
Figure 5. A novel primer pair TUBDcitri-F1 and TUBD-R1 was designed based on the alignment of the partial TUB gene (from 5´ to 3´) of Diaporthe species including D. citri, D. citriasiana, D. discoidispora, D. eres, D. infertilis, D. sojae, and D. unshiuensis. Dashes (−) and dots (.) indicate the gaps and identical nucleotides in the sequences, respectively.
Plants 09 00329 g005
Plants 09 00329 g006 550
Figure 6. Optimization of the annealing temperature. Lane 1–12 are results from the annealing temperature of 50, 50.7, 51.7, 53.1, 54.7, 56.4, 58.1, 59.8, 61.4, 62.7, 63.8, and 64.4 °C, respectively in reactions using DNA template of D. citri isolate NFHF-8-4. Lane 13 is the ddH2O as the template and lane M, 100 bp ladder.
Figure 6. Optimization of the annealing temperature. Lane 1–12 are results from the annealing temperature of 50, 50.7, 51.7, 53.1, 54.7, 56.4, 58.1, 59.8, 61.4, 62.7, 63.8, and 64.4 °C, respectively in reactions using DNA template of D. citri isolate NFHF-8-4. Lane 13 is the ddH2O as the template and lane M, 100 bp ladder.
Plants 09 00329 g006
Plants 09 00329 g007 550
Figure 7. Specificity and sensitivity of the developed PCR based on TUB sequence for detection of D. citri. (A) PCR product 217 bp of D. citri (NFHF-8-4) was shown with 2% gel electrophoresis (lane 1). Lanes 2–6 are representatives of D. citriasiana (XFAL-1-1), D. discoidispora (NKDL-1-2), D. eres (NFIF-1-1), D. sojae (NFGL-1-5), and D. unshiuensis (NFIF-1-6), respectively, Lane 7 is the double sterile water (ddH2O) as negative control, and lane M, 50 bp ladder. (B) Sensitivity was investigated with a gDNA serial dilution. Lane 1–8 are gDNA of 102, 101, 100, 10−1, 10−2, 10−3, 10−4, and 0 ng in 20 μL reaction mixture, respectively. Lane 9 is the ddH2O as negative control and lane M, 50 bp ladder.
Figure 7. Specificity and sensitivity of the developed PCR based on TUB sequence for detection of D. citri. (A) PCR product 217 bp of D. citri (NFHF-8-4) was shown with 2% gel electrophoresis (lane 1). Lanes 2–6 are representatives of D. citriasiana (XFAL-1-1), D. discoidispora (NKDL-1-2), D. eres (NFIF-1-1), D. sojae (NFGL-1-5), and D. unshiuensis (NFIF-1-6), respectively, Lane 7 is the double sterile water (ddH2O) as negative control, and lane M, 50 bp ladder. (B) Sensitivity was investigated with a gDNA serial dilution. Lane 1–8 are gDNA of 102, 101, 100, 10−1, 10−2, 10−3, 10−4, and 0 ng in 20 μL reaction mixture, respectively. Lane 9 is the ddH2O as negative control and lane M, 50 bp ladder.
Plants 09 00329 g007
Table
Table 1. Collection details and GenBank accession numbers of isolates included in this study.
Table 1. Collection details and GenBank accession numbers of isolates included in this study.
Diaporthe Species Isolate Number Plant Host Tissue Locality GenBank Accession Numbers 1
ITS TUB TEF CAL HIS
D. citri NFFF-1-2 Citrus reticulata cv. Nanfengmiju fruit China: Jiangxi: Nanfeng MN816394 MN894454 MN894415 MN894355 MN894380
NFFF-1-4 Citrus reticulata cv. Nanfengmiju fruit China: Jiangxi: Nanfeng MN816395 MN894455 MN894416 MN894356 MN894381
NFFF-2-5 Citrus reticulata cv. Nanfengmiju fruit China: Jiangxi: Nanfeng MN816396 MN894456 MN894417 MN894357 MN894382
NFFL-1-13 Citrus reticulata cv. Nanfengmiju leaf China: Jiangxi: Nanfeng MN816397 MN894457 MN894418 MN894358 –
NFFL-1-8 Citrus reticulata cv. Nanfengmiju leaf China: Jiangxi: Nanfeng MN816398 MN894458 MN894419 MN894359 –
NFHF-8-4 Citrus reticulata cv. Nanfengmiju fruit China: Jiangxi: Nanfeng MN816399 MN894459 MN894420 MN894360 –
NFHL-7-11 Citrus reticulata cv. Nanfengmiju leaf China: Jiangxi: Nanfeng MN816400 MN894460 MN894421 MN894361 MN894383
NKDL-2-17 Citrus sinensis leaf China: Jiangxi: Nankang MN816401 MN894461 MN894422 MN894362 MN894384
NKCL-6-12 Citrus sinensis leaf China: Jiangxi: Nankang MN816402 MN894462 MN894423 MN894363 MN894385
NKCT-6-24 Citrus sinensis twig China: Jiangxi: Nankang MN816403 MN894463 MN894424 MN894364 MN894386
D. citriasiana XFAL-1-1 Citrus sinensis leaf China: Jiangxi: Xinfeng MN816404 MN894464 MN894425 – MN894387
NFFL-2-41 Citrus reticulata cv. Nanfengmiju leaf China: Jiangxi: Nanfeng MN816405 MN894465 MN894426 – MN894388
XFKL-15-2 Citrus sinensis leaf China: Jiangxi: Xinfeng MN816406 MN894466 MN894427 – MN894389
D. discoidispora NFJF-1-1 Citrus reticulata cv. Nanfengmiju fruit China: Jiangxi: Nanfeng MN816407 MN894467 MN894428 – MN894390
NKDL-1-2 Citrus sinensis leaf China: Jiangxi: Nankang MN816408 MN894468 MN894429 – MN894391
NKDL-2-3 Citrus sinensis leaf China: Jiangxi: Nankang MN816409 MN894469 MN894430 – MN894392
NKDL-1-6 Citrus sinensis leaf China: Jiangxi: Nankang MN816410 MN894470 MN894431 – MN894393
NFFL-3-46 Citrus reticulata cv. Nanfengmiju leaf China: Jiangxi: Nanfeng MN816411 MN894471 MN894432 – MN894394
D. eres NFFL-1-25 Citrus reticulata cv. Nanfengmiju leaf China: Jiangxi: Nanfeng MN816412 MN894472 MN894433 – MN894395
NFFL-1-36 Citrus reticulata cv. Nanfengmiju leaf China: Jiangxi: Nanfeng MN816413 MN894473 MN894434 MN894365 MN894396
NFFL-2-17 Citrus reticulata cv. Nanfengmiju leaf China: Jiangxi: Nanfeng MN816414 MN894474 MN894435 – MN894397
NFFL-2-8 Citrus reticulata cv. Nanfengmiju leaf China: Jiangxi: Nanfeng MN816415 MN894475 MN894436 MN894366 MN894398
NFFL-3-1 Citrus reticulata cv. Nanfengmiju leaf China: Jiangxi: Nanfeng MN816416 MN894476 MN894437 MN894367 MN894399
NFFL-4-5 Citrus reticulata cv. Nanfengmiju leaf China: Jiangxi: Nanfeng MN816417 MN894477 MN894438 MN894368 MN894400
NFFT-3-3 Citrus reticulata cv. Nanfengmiju twig China: Jiangxi: Nanfeng MN816418 MN894478 MN894439 – MN894401
NFFT-3-8 Citrus reticulata cv. Nanfengmiju twig China: Jiangxi: Nanfeng MN816419 MN894479 MN894440 MN894369 MN894402
NFIF-1-1 Citrus reticulata cv. Nanfengmiju fruit China: Jiangxi: Nanfeng MN816420 MN894480 MN894441 MN894370 MN894403
NFIF-1-7 Citrus reticulata cv. Nanfengmiju fruit China: Jiangxi: Nanfeng MN816421 MN894481 MN894442 – MN894404
D. sojae NFGL-1-5 Citrus reticulata cv. Nanfengmiju leaf China: Jiangxi: Nanfeng MN816422 MN894482 MN894443 MN894371 MN894405
NFIT-3-13 Citrus reticulata cv. Nanfengmiju twig China: Jiangxi: Nanfeng MN816423 MN894483 MN894444 MN894372 MN894406
NFIF-1-10 Citrus reticulata cv. Nanfengmiju fruit China: Jiangxi: Nanfeng MN816424 MN894484 MN894445 MN894373 MN894407
NFFL-1-27 Citrus reticulata cv. Nanfengmiju leaf China: Jiangxi: Nanfeng MN816425 MN894485 MN894446 MN894374 MN894408
NFGL-1-7 Citrus reticulata cv. Nanfengmiju leaf China: Jiangxi: Nanfeng MN816426 MN894486 MN894447 MN894375 MN894409
D. unshiuensis NFIF-1-6 Citrus reticulata cv. Nanfengmiju fruit China: Jiangxi: Nanfeng MN816427 MN894487 MN894448 MN894376 –
NFFT-4-5 Citrus reticulata cv. Nanfengmiju twig China: Jiangxi: Nanfeng MN816428 MN894488 MN894449 – MN894410
NKCT-6-4 Citrus sinensis twig China: Jiangxi: Nankang MN816429 MN894489 MN894450 – MN894411
NKCL-6-15 Citrus sinensis leaf China: Jiangxi: Nankang MN816430 MN894490 MN894451 MN894377 MN894412
NKCT-6-20 Citrus sinensis twig China: Jiangxi: Nankang MN816431 MN894491 MN894452 MN894378 MN894413
1 ITS = nuclear ribosomal internal transcribed spacer regions; TUB = beta-tubulin gene; TEF = translation elongation factor 1-α gene; HIS = histone-3 gene; and CAL = calmodulin gene.
Table
Table 2. Comparison of alignment properties in parsimony analyses of gene/locus and nucleotide substitution models used in phylogenetic analyses.
Table 2. Comparison of alignment properties in parsimony analyses of gene/locus and nucleotide substitution models used in phylogenetic analyses.
Gene/Locus ITS TEF TUB CAL HIS Combined
No. of taxa 129 124 124 68 112 129
Aligned length (with gaps) 645 472 893 617 540 3183
Invariable characters (%) 414 (64.19) 186 (39.41) 523 (58.57) 310 (50.24) 352 (65.19) 1801 (56.58)
Phylogenetically informative characters (%) 123 (19.07) 230 (48.73) 263 (29.45) 238 (38.57) 143 (26.48) 997 (31.32)
Uninformative variable characters (%) 108 (16.74) 56 (11.86) 107 (11.98) 69 (11.18) 45 (8.33) 385 (12.10)
Tree length (TL) 670 856 745 554 538 3,654
Consistency index (CI) 0.506 0.575 0.686 0.773 0.55 0.565
Retention index (RI) 0.901 0.948 0.94 0.952 0.926 0.921
Rescaled consistency index (RC) 0.456 0.545 0.645 0.735 0.509 0.521
Homoplasy index (ID) 0.494 0.425 0.314 0.227 0.45 0.435
Nucleotide substitution model GTR + I + G GTR + I + G HKY + G GTR + G GTR + I + G GTR + I + G
Table
Table 3. Universal and species-specific primers used in PCR reactions with Diaporthe spp.
Table 3. Universal and species-specific primers used in PCR reactions with Diaporthe spp.
Primer Name Primer Sequences (5´ to 3´) Length (nt) 1 Ta (°C) 2 %GC Reference
ITS1 TCCGTAGGTGAACCTGCGG 19 55.0 63.2 White, et al. [65]
ITS4 TCCTCCGCTTATTGATATGC 20 45.0 White, et al. [65]
EF1-728F CATCGAGAAGTTCGAGAAGG 20 58.0 50.0 Carbone and Kohn [66]
EF1-986R TACTTGAAGGAACCCTTACC 20 45.0 Carbone and Kohn [66]
Bt2a GGTAACCAAATCGGTGCTGCTTTC 24 58.0 50.0 Glass and Donaldson [67]
Bt2b ACCCTCAGTGTAGTGACCCTTGGC 24 58.0 Glass and Donaldson [67]
TUBDcitri-F1 CCATTTGACCATCTGCAACAT 21 55.0 42.9 This study
TUBD-R1 CCTTGGCCCAGTTGTTTCC 19 57.9 This study
CAL-228F GAGTTCAAGGAGGCCTTCTCCC 22 55.0 59.0 Carbone and Kohn [66]
CAL-737R CATCTTCTGGCCATCATGG 19 52.6 Carbone and Kohn [66]
CYLH3F AGGTCCACTGGTGGCAAG 18 58.0 61.1 Crous, et al. [68]
H3-1b GCGGGCGAGCTGGATGTCCTT 21 66.6 Glass and Donaldson [67]
1 Number of nucleotides. 2 Annealing temperature estimated by Primer Premier v.6.0.
Table
Table 4. List of Diaporthe species used for phylogenetic analyses.
Table 4. List of Diaporthe species used for phylogenetic analyses.
Species Isolate Number 1,2 Plant Host Locality GenBank Accession Numbers 3 Reference(s)
ITS TUB TEF CAL HIS
Diaporthe arecae CBS 161.64 IT Areca catechu Unknown KC343032 KC344000 KC343758 KC343274 KC343516 Gomes, et al. [6]
CBS 535.75 Citrus sp. Suriname KC343033 KC344001 KC343759 KC343275 KC343517 Gomes, et al. [6]
ZJUD58 Citrus limon China: Yunnan KJ490593 KJ490414 KJ490472 – KJ490535 Huang, et al. [48]
ZJUD59 Citrus sinensis China: Jiangxi KJ490594 KJ490415 KJ490473 – KJ490536 Huang, et al. [48]
D. baccae CBS 136,972 T Vaccinium corymbosum Italy: Sicily, Catania KJ160565 MF418509 KJ160597 – MF418264 Guarnaccia and Crous [20], Lombard, et al. [75]
CPC 26170 Citrus sinensis Italy: Catania MF418351 MF418510 MF418430 MF418185 MF418265 Guarnaccia and Crous [20]
CPC 26465 Citrus limon Italy: Catania MF418352 MF418511 MF418431 MF418186 MF418266 Guarnaccia and Crous [20]
CPC 26963 Citrus paradisi Italy: Vibo Valentia MF418353 MF418512 MF418432 MF418187 MF418267 Guarnaccia and Crous [20]
CPC 27821 Citrus reticulata Italy: Cosenza MF418357 MF418516 MF418436 MF418191 MF418271 Guarnaccia and Crous [20]
D. biconispora CGMCC3.17252 T Citrus grandis China: Fujian KJ490597 KJ490418 KJ490476 – KJ490539 Huang, et al. [48]
ZJUD60 Citrus sinensis China: Jiangxi KJ490595 KJ490416 KJ490474 – KJ490537 Huang, et al. [48]
ZJUD61 Fortunella margarita China: Guangxi KJ490596 KJ490417 KJ490475 – KJ490538 Huang, et al. [48]
D. biguttulata CGMCC3.17248 T Citus limon China: Yunnan KJ490582 KJ490403 KJ490461 – KJ490524 Huang, et al. [48]
ZJUD48 Citrus limon China: Yunnan KJ490583 KJ490404 KJ490462 – KJ490525 Huang, et al. [48]
D. citri AR3405 T Citrus sp. USA: Florida KC843311 KC843187 KC843071 KC843157 MF418281 Guarnaccia and Crous [20], Udayanga, et al. [24]
CBS 134,239 T Citrus sinensis USA: Florida KC357553 KC357456 KC357522 KC357488 MF418280 Guarnaccia and Crous [20], Huang, et al. [21]
ZJUD1 Citrus reticulata China: Zhejiang JQ954654 KJ490395 JQ954671 – KJ490514 Huang, et al. [21], Huang, et al. [48]
CBS 144227 Citrus reticulata Portugal: Azores MH063904 MH063916 MH063910 MH063892 MH063898 Guarnaccia and Crous [20]
CBS 135426 Citrus unshiu cv. Juwadeun Korea: Odeung-dong KC843324 KC843200 KC843084 KC843170 – Udayanga, et al. [24]
ICMP 10355 Citrus reticulata New Zealand: Kerikeri KC843314 KC843190 KC843074 KC843160 – Udayanga, et al. [24]
Ph-18 Citrus sinensis Panama: Coclé MK214464 – MK283703 – – Aguilera-Cogley and Vicent [76]
FCDC2 Citrus sp. Japan: Fukuoka AB302249 – – – – Kanematsu, et al. [77], Kanematsu [78]
D. citriasiana CGMCC3.15224 T Citrus unshiu China: Shaanxi JQ954645 KC357459 JQ954663 KC357491 MF418282 Guarnaccia and Crous [20], Huang, et al. [21]
ZJUD33 Citrus paradisi China: Jiangxi JQ954658 KC357460 JQ972716 KC357493 – Huang, et al. [21]
ZJUD81 Citrus grandis cv. Shatianyou China: Zhejiang KJ490616 KJ490437 KJ490495 – KJ490558 Huang, et al. [48]
D. citrichinensis CGMCC3.15225 T Citrus unshiu China: Shaanxi JQ954648 MF418524 JQ954666 KC357494 KJ490516 Guarnaccia and Crous [20], Huang, et al. [21,48]
ZJUD034B Citrus unshiu China: Shaanxi KJ210539 KJ420829 KJ210562 KJ435042 KJ420879 Udayanga, et al. [24], Udayanga, et al. [39]
ZJUD38 Citrus unshiu China: Shaanxi KC357558 KC357463 KC357527 KC357498 – Huang, et al. [21]
ZJUD85 Fortunella margarita China: Guangxi KJ490620 KJ490441 KJ490499 – KJ490562 Huang, et al. [48]
ZJUD96 Citrus unshiu China: Fujian KJ490631 KJ490452 KJ490510 – KJ490573 Huang, et al. [48]
ZJUD97 Citrus grandis China: Fujian KJ490632 KJ490453 KJ490511 – KJ490574 Huang, et al. [48]
D. cytosporella CBS 137,020 T Citrus limon Spain KC843307 KC843221 KC843116 KC843141 MF418283 Guarnaccia and Crous [20], Udayanga, et al. [24]
AR5149 Citrus sinensis USA: California KC843309 KC843222 KC843118 KC843143 – Udayanga, et al. [24]
D. discoidispora CGMCC3.17255 T Citrus unshiu China: Jiangxi KJ490624 KJ490445 KJ490503 – KJ490566 Huang, et al. [48]
D. endophytica CBS 133,811 T Schinus terebinthifolius Brazil KC343065 KC344033 KC343791 KC343307 KC343549 Gomes, et al. [6]
ZJUD73 Citrus unshiu China: Fujian KJ490608 KJ490429 KJ490487 – KJ490550 Huang, et al. [48]
ZJUD94 Citrus limon China: Yunnan KJ490629 KJ490450 KJ490508 – KJ490571 Huang, et al. [48]
D. eres CGMCC3.17081 T Lithocarpus glabra China: Zhejiang KF576282 KF576306 KF576257 – – Gao, et al. [79]
CGMCC3.17089 T Lithocarpus glabra China: Zhejiang KF576267 KF576291 KF576242 – – Gao, et al. [79]
ZJUD84 Fortunella margarita China: Guangxi KJ490619 KJ490440 KJ490498 – KJ490561 Huang, et al. [48]
ZJUD90 Citrus unshiu China: Jiangxi KJ490625 KJ490446 KJ490504 – KJ490567 Huang, et al. [48]
ZJUD91 Citrus sp. China: Jiangxi KJ490626 KJ490447 KJ490505 – KJ490568 Huang, et al. [48]
ZJUD92 Citrus sp. China: Zhejiang KJ490627 KJ490448 KJ490506 – KJ490569 Huang, et al. [48]
D. foeniculina CBS 123,208 T Foeniculum vulgare Portugal: Évora KC343104 KC344072 KC343830 KC343346 KC343588 Gomes, et al. [6]
CBS 135430 Citrus limon USA: California KC843301 KC843215 KC843110 KC843135 MF418284 Guarnaccia and Crous [20], Udayanga, et al. [24]
CPC 26184 Citrus maxima Italy: Messina MF418365 MF418525 MF418444 MF418199 MF418285 Guarnaccia and Crous [20]
CPC 26885 Citrus bergamia Greece: Missolonghi MF418374 MF418534 MF418453 MF418208 MF418294 Guarnaccia and Crous [20]
CPC 26967 Citrus mitis Italy: Messina MF418379 MF418539 MF418458 MF418213 MF418299 Guarnaccia and Crous [20]
CPC 27895 Citrus japonica Malta: Gozo MF418391 MF418551 MF418470 MF418225 MF418311 Guarnaccia and Crous [20]
CPC 27945 Citrus paradisi Portugal: Faro MF418397 MF418557 MF418476 MF418231 MF418317 Guarnaccia and Crous [20]
CPC 28033 Citrus sinensis Portugal: Mesquita MF418402 MF418562 MF418481 MF418236 MF418322 Guarnaccia and Crous [20]
CPC 28081 Citrus reticulata Spain: Algemesi MF418415 MF418575 MF418494 MF418249 MF418335 Guarnaccia and Crous [20]
CPC 28163 Microcitrus australasica Italy: Catania MF418416 MF418576 MF418495 MF418250 MF418336 Guarnaccia and Crous [20]
D. hongkongensis HKUCC 9104 T Dichroa febrifuga Hong Kong: China KC343119 KC344087 KC343845 KC343361 KC343603 Gomes, et al. [6]
ZJUD74 Citrus unshiu China: Fujian KJ490609 KJ490430 KJ490488 – KJ490551 Huang, et al. [48]
ZJUD75 Citrus reticulata China: Fujian KJ490610 KJ490431 KJ490489 – KJ490552 Huang, et al. [48]
ZJUD76 Citrus reticulata cv. Nanfengmiju China: Jiangxi KJ490611 KJ490432 KJ490490 – KJ490553 Huang, et al. [48]
ZJUD77 Citrus unshiu China: Zhejiang KJ490612 KJ490433 KJ490491 – KJ490554 Huang, et al. [48]
ZJUD78 Citrus grandis China: Fujian KJ490613 KJ490434 KJ490492 – KJ490555 Huang, et al. [48]
ZJUD79 Citrus grandis China: Fujian KJ490614 KJ490435 KJ490493 – KJ490556 Huang, et al. [48]
D. infertilis CBS 230.52 T Citrus sinensis Suriname: Paramaribo KC343052 KC344020 KC343778 KC343294 KC343536 Gomes, et al. [6]
CBS 199.39 Unknown Italy KC343051 KC344019 KC343777 KC343293 KC343535 Gomes, et al. [6]
CPC 20322 Glycine max Brazil KC343053 KC344021 KC343779 KC343295 KC343537 Gomes, et al. [6]
Pc4 Citrus limon India KJ477016 – – – – Mahadevakumar, et al. [80]
G-01 Mikania glomerata Brazil KJ934221 KT962837 KT962838 – – Polonio, et al. [81], Polonio, et al. [82]
G-02 Mikania glomerata Brazil KJ934219 – – – – Polonio, et al. [81]
G-03 Mikania glomerata Brazil KJ934220 – – – – Polonio, et al. [81]
D. limonicola CBS 142,549 T Citrus limon Malta: Gozo MF418422 MF418582 MF418501 MF418256 MF418342 Guarnaccia and Crous [20]
CPC 31137 Citrus limon Malta: Zurrieq MF418423 MF418583 MF418502 MF418257 MF418343 Guarnaccia and Crous [20]
D. melitensis CBS 142,551 T Citrus limon Malta: Gozo MF418424 MF418584 MF418503 MF418258 MF418344 Guarnaccia and Crous [20]
CPC 27875 Citrus limon Malta: Gozo MF418425 MF418585 MF418504 MF418259 MF418345 Guarnaccia and Crous [20]
D. multigutullata CGMCC3.17258 T Citrus grandis China: Fujian KJ490633 KJ490454 KJ490512 – KJ490575 Huang, et al. [48]
D. novem CBS 127,270 T Glycine max Croatia KC343156 KC344124 KC343882 KC343398 KC343640 Gomes, et al. [6]
CPC 26188 Citrus japonica Italy: Messina MF418426 MF418586 MF418505 MF418260 MF418346 Guarnaccia and Crous [20]
CPC 28165 Citrus aurantiifolia Italy: Catania MF418427 MF418587 MF418506 MF418261 MF418347 Guarnaccia and Crous [20]
CPC 28167 Citrus aurantiifolia Italy: Catania MF418428 MF418588 MF418507 MF418262 MF418348 Guarnaccia and Crous [20]
CPC 28169 Citrus aurantiifolia Italy: Catania MF418429 MF418589 MF418508 MF418263 MF418349 Guarnaccia and Crous [20]
D. ovalispora CGMCC3.17256 T Citrus limon China: Yunnan KJ490628 KJ490449 KJ490507 – KJ490570 Huang, et al. [48]
D. sojae CBS 139,282 ET Glycine max USA: Ohio KJ590719 KJ610875 KJ590762 KJ612116 KJ659208 Udayanga, et al. [51]
ZJUD68 Citrus unshiu China: Zhejiang KJ490603 KJ490424 KJ490482 – KJ490545 Huang, et al. [48]
ZJUD69 Citrus reticulata cv. Nanfengmiju China: Jiangxi KJ490604 KJ490425 KJ490483 – KJ490546 Huang, et al. [48]
ZJUD70 Citrus limon China: Yunnan KJ490605 KJ490426 KJ490484 – KJ490547 Huang, et al. [48]
ZJUD71 Citrus reticulata China: Zhejiang KJ490606 KJ490427 KJ490485 – KJ490548 Huang, et al. [48]
ZJUD72 Citrus reticulata China: Yunnan KJ490607 KJ490428 KJ490486 – KJ490549 Huang, et al. [48]
D. subclavata CGMCC3.17257 T Citrus unshiu China: Fujian KJ490630 KJ490451 KJ490509 – KJ490572 Huang, et al. [48]
ZJUD83 Citrus grandis cv. Shatianyou China: Guangdong KJ490618 KJ490439 KJ490497 – KJ490560 Huang, et al. [48]
D. unshiuensis CGMCC3.17569 T Citrus unshiu China: Zhejiang KJ490587 KJ490408 KJ490466 – KJ490529 Huang, et al. [48]
CGMCC3.17566 Fortunella margarita China: Guilin KJ490584 KJ490405 KJ490463 – KJ490526 Huang, et al. [48]
CGMCC3.17567 Fortunella margarita China: Guilin KJ490585 KJ490406 KJ490464 – KJ490527 Huang, et al. [48]
CGMCC3.17568 Fortunella margarita China: Guilin KJ490586 KJ490407 KJ490465 – KJ490528 Huang, et al. [48]
Diaporthella corylina CBS 121,124 T Corylus sp. China: Heilongjiang KC343004 KC343972 KC343730 KC343246 KC343488 Gomes, et al. [6], Vasilyeva, et al. [83]
1 IT = ex-isotype, T = ex-type, and EP = ex-epitype. 2 AR = Corresponding author’s personal collection of A.Y. Rossman; CBS = Westerdijk Fungal Biodiversity Institute (formerly CBSKNAW), Utrecht, The Netherlands; CFCC = China Forestry Culture Collection Center, China; CGMCC = China General Microbiological Culture Collection, China; CPC = Culture collection of P.W. Crous, housed at Westerdijk Fungal Biodiversity Institute, Utrecht, The Netherlands; HKUCC = University of Hong Kong Culture Collection, Department of Ecology and Biodiversity, Hong Kong, China; ICMP = International Collection of Micro-organisms from Plants, Auckland, New Zealand; and ZJUD = Diaporthe species culture collection at the Institute of Biotechnology, Zhejiang University, Hangzhou, China. 3 ITS = nuclear ribosomal internal transcribed spacer regions; TUB = beta-tubulin gene; TEF = translation elongation factor 1-α gene; HIS = histone-3 gene; and CAL = calmodulin gene.

Share and Cite

MDPI and ACS Style

Chaisiri, C.; Liu, X.-Y.; Lin, Y.; Li, J.-B.; Xiong, B.; Luo, C.-X. Phylogenetic Analysis and Development of Molecular Tool for Detection of Diaporthe citri Causing Melanose Disease of Citrus. Plants 2020, 9, 329. https://doi.org/10.3390/plants9030329

AMA Style

Chaisiri C, Liu X-Y, Lin Y, Li J-B, Xiong B, Luo C-X. Phylogenetic Analysis and Development of Molecular Tool for Detection of Diaporthe citri Causing Melanose Disease of Citrus. Plants. 2020; 9(3):329. https://doi.org/10.3390/plants9030329

Chicago/Turabian Style

Chaisiri, Chingchai, Xiang-Yu Liu, Yang Lin, Jiang-Bo Li, Bin Xiong, and Chao-Xi Luo. 2020. "Phylogenetic Analysis and Development of Molecular Tool for Detection of Diaporthe citri Causing Melanose Disease of Citrus" Plants 9, no. 3: 329. https://doi.org/10.3390/plants9030329

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop