INTRODUCTION
A hallmark of HIV disease is profound depletion of CD4 T-cells from gastrointestinal-associated lymphoid tissue (GALT) very early with primary infection.1 + lymphocytes are infected and presumably destroyed by viral infection.2,3 4,5 + lymphocyte depletion from GALT is believed to be gut microbial translocation as measured by blood concentrations of lipopolysaccharide (LPS), detection of universally conserved microbial 16S ribosomal RNA gene sequences (rDNA) in plasma, and increased levels of peripheral blood CD8+ T-cell subsets with an activated phenotype.6,7 + T-cell activation was recognized as a key predictor of HIV disease progression very early in the epidemic, but the causes for these elevations remain uncertain.8,9 + T-cell activation decline with antiretroviral treatment (ART) suppression of HIV plasma viral loads but infrequently achieve the levels of HIV-negative controls. Thus, persistently elevated fractions of activated CD8+ T-cells despite suppressed HIV viremia suggest that multiple factors contribute to this abnormality.10 11 + T-cell activation, sCD14 levels correlate with HIV disease progression and death and may represent a surrogate marker for bacterial translocation.12-14
The influence of the gut microbiota composition on a variety of disease states has gained recent attention.15 16-18
Despite recent observations of the correlation between plasma bacterial proinflammatory antigens and HIV-associated immune activation, the potential relationships between gut microbiota composition at a higher taxonomic level and HIV-associated systemic immunologic defects has not been explored using molecular quantitative techniques. Although other investigators have focused on the impact of bacterial translocation on systemic immune activation in chronic HIV disease, we sought to first explore whether the bacterial populations in the intestinal lumen influence local and systemic immunologic parameters. We designed a set of pilot experiments to test the hypotheses that increased proportions of Enterobacteriales and Bacteroidales in the gut correlate with GALT CD4+ T-cell depletion and peripheral blood CD8+ T-cell activation in patients with HIV. Enterobacteriales is a facultative-anaerobic taxon generally residing in human small bowel niches and Bacteroidales are quantitatively dominant obligate-anaerobic taxa generally residing in human large bowel niches. Both contain classically Gram-negative staining, proinflammatory/LPS-containing pathogens that have been associated with disease in other settings.19
METHODS
Clinical Design
Specimens from 12 HIV-infected subjects and five control subjects were used for this pilot project. All subjects signed an informed consent form approved by the University of California-Davis Institutional Review Board. Ten subjects underwent upper endoscopy for distal duodenal biopsy and stool collection before initiating ART and six had the same procedure performed after 9 months of ART. Only four of these six subjects had baseline stool samples available for longitudinal analysis.
Tissue and Cellular Analyses
Duodenal biopsies were either paraffin-embedded for immunohistochemical (IHC) analysis or underwent digestion to single-cell suspension for flow cytometry.20 Figure 1 .
FIGURE 1:
Gating algorithm for lymphocyte analysis in peripheral blood mononuclear cell and duodenal tissue. Gating strategy for all analysis first involved exclusion of dead cells as determined by viability dye exclusion staining followed by doublet discrimination gating for cells along the diagonal of the height and integrated area of the forward scatter signal. Gating was then carried forward of the CD3-positive population and CD4+ and CD8+ bivariate analysis.
For IHC analysis, the primary antibodies were polyclonal anti-CD3 rabbit serum (Dako Inc, Carpinteria, CA) and monoclonal anti-CD4 mouse serum (Vector, Burlingame, CA). Binding of CD3 and CD4 receptors was detected simultaneously using Alexafluor 488-labeled polyclonal goat antirabbit IgG (Molecular Probes, Eugene, OR) and Alexafluor 568-labeled polyclonal goat antimouse IgG (Molecular Probes). The numbers of positive cells were counted by a single observer (Z.-M.M.) and presented as cells/millimeter2 21,22 Figure 2 .
FIGURE 2:
Immunohistochemistry of duodenal tissue sections: IHC staining of duodenal tissue for double-positive intraepithelial (IEL) and lamina propria lymphocytes (LPL) for nuclei (DAPI blue), CD3 (Alexa Fluor 488, green) and CD4 (Alexa Fluor 568, red). No IEL (thick arrow) and few LPL (thin arrows) are seen in sections from HIV positive subjects (A) compared with control subjects (B). Mean duodenal CD3+ /CD4+ count is 149 cell/mm2 (± 44 cell/mm2 ) for pre-ART subjects by IHC and 154 cell/mm2 (× 25 cell/mm2 ) for post-ART subjects. All samples were read by a single observer blinded to the cohort assignment (Z.-M.M.). IHC, immunohistochemistry; ART, antiretroviral treatment.
Stool DNA Extraction/Analysis
Metagenomic microbial DNA was extracted by standard phenol-chloroform-ethanol-based methods from frozen stools as described by Hartman et al.23 23
Primers (ATCC, Manassas, VA)
Our chosen quantitative polymerase chain reaction oligonucleotide primers have been confirmed for specificity and validity using the Ribosomal Database Project (RDP) probe-match web site.24
The Panbacteria (total bacterial load)
This forward/reverse (F/R) primer had a melting T (Tm ) of 65.5°, an amplicon size of 180 base pairs (bp), a 16S position at 334-514, F/R coverage was 68/71%, a serially diluted genomic standardization curve (note any bacterial species could have been used) with Escherichia coli at 4.3 × 107 copies in 2 μL nuclease-free water, an experimental water control run in-parallel, and the following genomic sequences: F primer ACTCCTACGGGAGGCAGCAGT; R primer ATTACCGCGGCTGCTGGC.25
The Bacteroidales Order (class Bacteroidetes) From the Phylum Bacteroidetes
This F/R primer set had a Tm of 61°, an amplicon size of 151 bp, a 16S position at 1038-1189, F/R coverage of 56/59%, a serially diluted genomic standardization curve with Bacteroides fragilis at 8.15 × 107 copies in 2 μL nuclease-free water, an experimental water control run in-parallel, and the following genomic sequences: F primer GGTGTCGGCTTAAGTGCCAT; R primer CGGAYGTAAGGGCCGTGC.26
The Clostridiales Order (class Clostridia) From the low-C+C Phylum Firmicutes
This F/R primer set had a Tm of 60°, an amplicon size of 429 bp, a 16S position at 477-906, F/R coverage of 34/33% with subgroup F/R coverage of Lachnospiraceae of 76/65%, a serially diluted genomic standardization curve with Ruminococcus productus at 4.4 × 107 copies in 2 μL nuclease-free water, an experimental water control run in-parallel, and the following genomic sequences: F primer CGGTACCTGACTAAGAAGC; R primer AGTTTYATTCTTGCGAACG.26
The Enterobacteriales Order (class Gamma-Proteobacteria) From the Phylum Proteobacteria
This F/R primer had a Tm of 60.5°, an amplicon size of 177 bp, a 16S position at 1475-1652, F/R coverage of 59/34%, a serially diluted genomic standardization curve with Escherichia coli at 4.3 × 107 copies in 2 μL nuclease-free water, an experimental water control run in-parallel, and the following genomic sequences: F primer ATGGCTGTCGTCAGCTCGT; R primer CCTACTTCTTTTGCAACCCACTC.27
Each quantitative polymerase chain reaction well was run in triplicates and contained 10 μL of 2× Takara Perfect Real Time master mix (Takara Bio Inc, Otsu, Shiga, Japan), which included: 7.2 μL of water, 0.8 μL of a 10 μM F/R primer mix, and 2 μL of either an optimized dilution of 1:500 of extracted template DNA in nuclease-free water for specimen analysis or a serial dilution series of bacterial reference genomic DNA for standard curves. All reactions were paralleled by a nontemplate water control analysis (through the same nuclease-free water stock used for the other parallel reactions within the same experiment). Cycling conditions were: 95°C for 20 seconds; 40 repeats of the following steps: 95°C for 4 seconds, 30-second annealing. SYBR green fluorescence was detected with a BioRad Chromo4 Real Time PCR Detector on a Dyad Disciple Peltier Thermal Cycler (Bio-Rad Life Science Research, Hercules, CA). Melting curves were obtained from 55°C to 90°C with fluorescence measurements taken at every 1°C increase in temperature. Mean triplicate numbers of 16S amplicons/μL stool aliquot detected ≥ log-fold above background noise control were considered signal using MJ Opticon Monitor Analysis Software, Version 3.1 (Bio-Rad Life Science Research). Quality control parameters included amplification detection only at Cycle 10 or later, parallel slopes in log view, and an R 2 (correlation coefficient) value of 0.990 or higher.
Soluble CD14 Assay
Soluble CD14 levels in plasma samples were quantified by enzyme-linked immunosorbent assay with the Quantikine Human sCD14 Immunoassay (R&D Systems, Minneapolis, MN) according to the manufacturer's protocol. Samples were assayed in duplicate.
Statistical Methods
For the purposes of this pilot analysis, all subjects who were treatment-naïve (n = 10) and compared with normal control subjects (n = 5). Panbacterial quantities measured were used as denominators to calculate fractions or relative proportions of individual order abundances. The two-sided Wilcoxon rank-sum test was used to compare the HIV-positive and control groups for numeric variables. The Spearman rank correlation coefficient was used to study the correlation between two quantitative variables. All analyses were performed with SAS Version 9.2 (SAS Institute Inc, Cary, NC). All values were expressed as mean + standard deviation (median; minimum, maximum).
RESULTS
Baseline Clinical Data Results
Baseline data are available for all subjects (Table 1 ). Women and minorities are well represented in this cohort, constituting 42% and 33% of the total, respectively. Control subjects (n = 5) were recruited from family and friends of clients in the HIV clinic who were of similar demographics. Mean + standard deviation (median; minimum, maximum) pretreatment plasma HIV load was 4.20 ± 0.64 (4.35; 2.99, 5.09) log10 cp/mL for all subjects and all plasma HIV loads were undetectable at the time of the second biopsy, except for one who experienced an isolated blip to 251 cp/mL.
TABLE 1:
Twelve Subjects Provided 16 Paired Stool-Duodenal Tissue/PBMC Samples for Inclusion in This Pilot Study*
Gut Tissue and Blood Analysis Results
Mean + standard deviation (median; minimum, maximum) duodenal CD3+ /CD4+ percent was 5.9% ± 3.2% (6.0%; 1.9%, 10.1%) for pre-ART subjects and 13.1% ± 6.8% (9.1%; 7.9%, 22.3%) for post-ART subjects. The frequency of circulating CD8+ T-cells with an activated CD38+ /HLA-DR+ phenotype was 50.9% ± 12.5% (53.1%; 30.8%, 63.4%) among the ART-naïve cohort and 29.8% ± 9.4% (28.5%; 18.8%, 42.0%) for ART-experienced subjects. In the duodenal tissue, the percent activated CD8+ and CD4+ T-cells was 60.6% ± 7.1% (61.6%; 48.4%, 68.9%) and 56.8% ± 8.6% (54.5%; 49.0%, 73.4%), respectively, among the ART-naïve cohort and 68.6% ± 11.4% (63.7%; 56.9%, 86.8%) and 54.7% ± 10.1% (53.8%; 44.3%, 67.2%), respectively, among the ART-experienced cohort. There was no difference in the duodenal tissue CD3+ /CD4+ count in the pretreatment versus on-therapy groups at 148.9 ± 44.2 (149; 81, 197) cell/mm2 versus 153.5 ± 24.7 (155.5; 119, 185) cell/mm2 , respectively. These data suggest that the duodenal tissue lymphocyte compartment is not in equilibrium with peripheral blood immune reconstitution observed after highly active ART therapy, especially with respect to absolute CD4+ T-cell density and T-lymphocyte activation.
Group Differences in Bacterial Taxa
Total quantity of universal bacterial 16S rDNA and the relative proportion of bacterial orders in the stool are represented in Figure 3A-D . Overall, the greatest quantity of panbacterial 16S rDNA was measured in the control population compared with the naïve HIV-positive population (5.5 ± 4.0 [4.6; 1.0, 10.4] vs 3.7 ± 3.2 [4.0; 0.00065, 10.5] [all × 108 /gram stool], respectively P > 0.1). There was a weak trend for a greater proportion of Enterobacteriales in HIV-positive patients compared with control subjects (0.320% ± 0.373% [0.168%; 0.000086, 1.058%] vs. 0.038% ± 0.047% [0015%; 0.0000186, 0.099%], P = 0.099). There were no significant differences in the total quantity of universal 16S rDNA measured nor in the proportion of bacterial orders comparing the other cohorts or orders.
FIGURE 3:
Total 16S rDNA and proportion of bacteria orders in stool by treatment group. (A) Total 16S rDNA in copies in millions of copies per gram stool wet weight. (B-D) Triplicate quantitative polymerase chain reaction mean assay results for Bacteroidales, Enterobacteriales, and Clostridiales orders expressed as a relative percent of the panbacterial/total 16S rDNA load for that sample as described in the “Methods” section (error bars represent the standard error of the mean).
We next explored correlations between the stool bacterial populations and tissue/peripheral parameters of immunity (Fig 4A-E ). There was a negative correlation between the number of total/universal microbial 16S rDNA and the duodenal CD8+ and CD4+ activated T-cells in the ART-naïve cohort (r = −0.67, P = 0.013 and r = −0.74, P = 0.004, respectively) noting that the control subjects had the highest levels of 16S rDNA measured (Fig 4A-B ). Higher fractions of Bacteroidales were significantly correlated with a higher percentage of CD8+ T-cells in peripheral blood mononuclear cells with the activated phenotype (Fig 4C ). This relationship held whether subjects were grouped as treatment-naive (n = 10) or all sample points (n = 16) (P = 0.019 and 0.016, respectively). Higher fractions of Enterobacteriales were significantly correlated with a low duodenal CD3+ /CD4+ count by IHC regardless of whether subjects were grouped as treatment-naive (n = 7) or all sample points (n = 13) (P = 0.023 and 0.013, respectively) (Fig 4D ). Interestingly, the correlation between CD4+ T-cell counts in the duodenal tissue by IHC and the proportion of Enterobacteriales was strengthened when the samples from control subjects were included in the analysis (r = −0.833, P = 0.005). No significant correlations were observed between Clostridiales order and tissue CD4+ T-cell count by IHC and CD8+ T-cell activation. Absolute peripheral CD4+ T-cell counts also did not correlate with any gut microbial quantitative measurements.
FIGURE 4:
Correlations between gut microbial communities and local and systemic immunologic parameters. (A-B) Correlation between total 16S rDNA and tissue T-cell activation percentage. (C) Correlation between Bacteroidales proportion in the stool and peripheral CD8+ T-cell activation levels. (D) Correlation between Enterobacteriales proportion in the stool and CD4+ T-cell numbers in the corresponding lamina propria by immunohistochemistry. (E) Correlation between plasma soluble CD14 in μg/mL and total 16S rDNA. For C and D, open circles, antiretroviral naïve subjects; solid circles, subjects after 9 months of therapy.
To explore whether the gut microbiota composition correlated with a surrogate marker for bacterial translocation ad hoc, plasma was available on a subset of subjects for sCD14 measurement (n = 13). The sCD14 levels were 1.59 + 0.40 μg/mL (1.6; 0.84, 2.21). There was a weak negative correlation between total/universal microbial 16S rDNA and sCD14 levels (r = −0.544, P = 0.055) (Fig 4E ), which was similar to the correlations observed between total/universal microbial 16S rDNA and CD4+ and CD8+ T-cell activation in duodenal tissue. Interestingly, no correlations were observed between sCD14 levels and peripheral blood mononuclear cell lymphocyte activation or individual microbiota orders. This suggests a possible intermediary such as bacterial product translocation or cytokine cascade as a primary consequence of total/universal microbial 16S levels in the gut of HIV-infected subjects.
DISCUSSION
These data represent the first report of quantitative molecular and cellular correlations between total/universal and order-level gut microbial populations and GALT levels of immune activation in the duodenum of HIV-infected subjects. Although the duodenal tissue and stool are located in distant locations in the gastrointestinal tract, it is important to recognize that the microbiota identified in the stool are derived from the populations of bacteria from throughout the intestinal tract as intraluminal contents shed communities by desquamation and mechanical motility. Notably, at higher taxonomic levels (ie, order-level), it is thought that the microbiota community structure is much more stable than lower taxa levels (ie, species) and therefore, the changes we observed were unlikely to be the result of day-to-day variability because significant perturbations (such as acute disease or drugs) would be required to cause these kinds of dramatic shifts.28-30
This work confirms and extends the observations published by Gori et al who reported that the frequency of Pseudomonas aeruginosa in the stools of HIV-infected subjects was higher than in historical controls from the normal population.31 P. aeruginosa , generally residing in small gut niches and producing strong TLR-4-stimulatory endotoxic-LPS was found in approximately 10-fold higher frequency in the HIV-positive subjects not on ART as compared with the control subjects (P = 0.099). Although the mechanisms of CD4+ T-cell depletion have been assumed to be multifactorial with accelerated immunosenescence as an important pathway, a contributing stimulus from proinflammatory Gram-negative gut bacteria has not previously been identified. However, several authors have suggested that increased gut permeability and plasma LPS levels are factors contributing to lymphocyte apoptosis.32 33
Our direct correlation of the quantitatively dominant obligate-anaerobic order Bacteroidales (which also contain Gram-negative/LPS-containing species) with peripheral CD8+ T-cell activation is the first report of a relationship between gut luminal bacterial contents and systemic immune activation in HIV-infected subjects. It is interesting to note that Bacteroidetes is a dominant anaerobic large bowel organism, whereas Enterobacteriales is thought to be more dominant in the small bowel where facultative anaerobes and aerotolerant species reside. Our results also confirm and extend the work by Jiang et al, who reported a correlation between systemic surrogate markers of bacterial translocation and immune activation.7
The inverse correlation observed between absolute bacterial numbers and tissue activation including both HIV-infected and control subjects suggests that this relationship represents a continuum of homeostatic factors influenced by the disease state. In HIV disease, the proinflammatory impact of a persistent systemic infection as well as bacterial antigen translocation likely amplifies the local tissue responses in the gastrointestinal tract. These data are consistent with the large body of literature on gnotobiotic animal models, which has demonstrated that the resident gut microbiota maintains baseline immune surveillance and health.34 35 35 36 37
Although the focus of this pilot project was on gut microbial communities and the local tissue environment, the finding of a weak correlation between sCD14 as well as both CD4+ and CD8+ T-cell activation in the duodenal tissue is supportive of the potential systemic effects of gut ecology. In this regard, our findings are consistent with the association between disruption of intestinal CD4+ T-cell homeostasis and systemic immune activation that was recently demonstrated by Gordon and colleagues.38
McKenna et al recently reported extensive sequencing analysis of 16S rDNA from multiple sites within the gastrointestinal tract of rhesus macaques.39
In summary, the observed correlations between proinflammatory populations of bacteria in the gut of chronically infected HIV subjects and immunologic abnormalities may be attributable in part to a number of factors. The selective effect of persistent HIV replication40 41 42
ACKNOWLEDGMENTS
The authors thank Dr Barbara Shacklett for her review and editing of the manuscript.
REFERENCES
1. Brenchley JM, Schacker TW, Ruff LE, et al. CD4+ T cell depletion during all stages of HIV disease occurs predominantly in the gastrointestinal tract.
J Exp Med . 2004;200:749-759.
2. Wang X, Rasmussen T, Pahar B, et al. Massive infection and loss of CD4+ T cells occurs in the intestinal tract of neonatal rhesus macaques in acute SIV infection.
Blood . 2007;109:1174-1181.
3. Mehandru S, Poles MA, Tenner-Racz K, et al. Primary HIV-1 infection is associated with preferential depletion of CD4+ T lymphocytes from effector sites in the gastrointestinal tract.
J Exp Med . 2004;200:761-770.
4. Gautreaux MD, Deitch EA, Berg RD. T lymphocytes in host defense against bacterial translocation from the gastrointestinal tract.
Infect Immun . 1994;62:2874-2884.
5. Gautreaux MD, Deitch EA, Berg RD. Bacterial translocation from the gastrointestinal tract to various segments of the mesenteric lymph node complex.
Infect Immun . 1994;62:2132-2134.
6. Brenchley JM, Price DA, Schacker TW, et al. Microbial translocation is a cause of systemic immune activation in chronic HIV infection.
Nat Med . 2006;12:1365-1371.
7. Jiang W, Lederman MM, Hunt P, et al. Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection.
J Infect Dis . 2009;199:1177-1185.
8. Giorgi JV, Detels R. T-cell subset alterations in HIV-infected homosexual men: NIAID Multicenter AIDS cohort study.
Clin Immunol Immunopathol . 1989;52:10-18.
9. Deeks SG, Kitchen CM, Liu L, et al. Immune activation set point during early HIV infection predicts subsequent CD4+ T-cell changes independent of viral load.
Blood . 2004;104:942-947.
10. Robbins GK, Spritzler JG, Chan ES, et al. Incomplete reconstitution of T cell subsets on combination antiretroviral therapy in the AIDS Clinical Trials Group protocol 384.
Clin Infect Dis . 2009;48:350-361.
11. Kitchens RL, Thompson PA. Modulatory effects of sCD14 and LBP on LPS-host cell interactions.
J Endotoxin Res . 2005;11:225-229.
12. Nockher WA, Bergmann L, Scherberich JE. Increased soluble CD14 serum levels and altered CD14 expression of peripheral blood monocytes in HIV-infected patients.
Clin Exp Immunol . 1994;98:369-374.
13. Lien E, Aukrust P, Sundan A, et al. Elevated levels of serum-soluble CD14 in human immunodeficiency virus type 1 (HIV-1) infection: correlation to disease progression and clinical events.
Blood . 1998;92:2084-2092.
14. Sandler NG, Wand H, Roque A, et al. Plasma levels of soluble CD14 independently predict mortality in HIV infection.
J Infect Dis . 2011;203:780-790.
15. Qin J, Li R, Raes J, et al. A human gut microbial gene catalogue established by metagenomic sequencing.
Nature . 2010;464:59-65.
16. Vaarala O, Atkinson MA, Neu J. The ‘perfect storm’ for type 1 diabetes: the complex interplay between intestinal microbiota, gut permeability, and mucosal immunity.
Diabetes . 2008;57:2555-2562.
17. Vijay-Kumar M, Aitken JD, Carvalho FA, et al. Metabolic syndrome and altered gut microbiota in mice lacking Toll-like receptor 5.
Science . 2010;328:228-231.
18. De La Serre CB, Ellis CL, Lee J, et al. Propensity to high-fat diet-induced obesity in rats is associated with changes in the gut microbiota and gut inflammation.
Am J Physiol Gastrointest Liver Physiol . 2010;299:G440-G448.
19. Garrett WS, Gallini CA, Yatsunenko T, et al. Enterobacteriaceae act in concert with the gut microbiota to induce spontaneous and maternally transmitted colitis.
Cell Host Microbe . 2010;8:292-300.
20. Shacklett BL, Yang O, Hausner MA, et al. Optimization of methods to assess human mucosal T-cell responses to HIV infection.
J Immunol Methods . 2003;279:17-31.
21. Li Q, Duan L, Estes JD, et al. Peak SIV replication in resting memory CD4+ T cells depletes gut lamina propria CD4+ T cells.
Nature . 2005;434:1148-1152.
22. Vaccari M, Boasso A, Ma ZM, et al. CD4+ T-cell loss and delayed expression of modulators of immune responses at mucosal sites of vaccinated macaques following SIV mac251. infection.
Mucosal Immunol . 2008;1:497-507.
23. Hartman AL, Lough DM, Barupal DK, et al. Human gut microbiome adopts an alternative state following small bowel transplantation.
Proc Natl Acad Sci U S A . 2009;106:17187-17192.
24. Cole JR, Wang Q, Cardenas E, et al. The Ribosomal Database Project: improved alignments and new tools for rRNA analysis.
Nucleic Acids Res . 2009;37:D141-D145.
25. Amann RI, Binder BJ, Olson RJ, et al. Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations.
Appl Environ Microbiol . 1990;56:1919-1925.
26. Rinttila T, Kassinen A, Malinen E, et al. Development of an extensive set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PCR.
J Appl Microbiol . 2004;97:1166-1177.
27. Castillo M, Martin-Orue SM, Manzanilla EG, et al. Quantification of total bacteria, enterobacteria and lactobacilli populations in pig digesta by real-time PCR.
Vet Microbiol . 2006;114:165-170.
28. Vanhoutte T, Huys G, Brandt E, et al. Temporal stability analysis of the microbiota in human feces by denaturing gradient gel electrophoresis using universal and group-specific 16S rRNA gene primers.
FEMS Microbiol Ecol . 2004;48:437-446.
29. Thompson CL, Hofer MJ, Campbell IL, et al. Community dynamics in the mouse gut microbiota: a possible role for IRF9-regulated genes in community homeostasis.
PLoS ONE . 2010;5:e10335.
30. Claesson MJ, Cusack S, O'Sullivan O, et al. Microbes and Health Sackler Colloquium: composition, variability, and temporal stability of the intestinal microbiota of the elderly.
Proc Natl Acad Sci U S A . 2011;108(suppl 1):4586-4591.
31. Gori A, Tincati C, Rizzardini G, et al. Early impairment of gut function and gut flora supporting a role for alteration of gastrointestinal mucosa in human immunodeficiency virus pathogenesis.
J Clin Microbiol . 2008;46:757-758.
32. Lackner AA, Mohan M, Veazey RS. The gastrointestinal tract and AIDS pathogenesis.
Gastroenterology . 2009;136:1965-1978.
33. Marchetti G, Bellistri GM, Borghi E, et al. Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy.
AIDS . 2008;22:2035-2038.
34. Tlaskalova-Hogenova H, Stepankova R, Hudcovic T, et al. Commensal bacteria normal microflora., mucosal immunity and chronic inflammatory and autoimmune diseases.
Immunol Lett . 2004;93:97-108.
35. Lupp C, Robertson ML, Wickham ME, et al. Host-mediated inflammation disrupts the intestinal microbiota and promotes the overgrowth of Enterobacteriaceae.
Cell Host Microbe . 2007;2:119-129.
36. Winter SE, Thiennimitr P, Winter MG, et al. Gut inflammation provides a respiratory electron acceptor for Salmonella.
Nature . 2010;467:426-429.
37. Winter SE, Keestra AM, Tsolis RM, et al. The blessings and curses of intestinal inflammation.
Cell Host Microbe . 2010;8:36-43.
38. Gordon SN, Cervasi B, Odorizzi P, et al. Disruption of intestinal CD4+ T cell homeostasis is a key marker of systemic CD4+ T cell activation in HIV-infected individuals.
J Immunol . 2010;185:5169-5179.
39. McKenna P, Hoffmann C, Minkah N, et al. The macaque gut microbiome in health, lentiviral infection, and chronic enterocolitis.
PLoS Pathog . 2008;4:e20.
40. Yukl SA, Gianella S, Sinclair E, et al. Differences in HIV burden and immune activation within the gut of HIV-positive patients receiving suppressive antiretroviral therapy.
J Infect Dis . 2010;202:1553-1561.
41. Nixon DE, Landay AL. Biomarkers of immune dysfunction in HIV.
Curr Opin HIV AIDS . 2010;5:498-503.
42. Estes JD, Harris LD, Klatt NR, et al. Damaged intestinal epithelial integrity linked to microbial translocation in pathogenic simian immunodeficiency virus infections.
PLoS Pathog . 2010;6.
