Open-Label, Exploratory Phase II Trial of Oral Itraconazole for the Treatment of Basal Cell Carcinoma
Publication: Journal of Clinical Oncology
Abstract
Purpose
Itraconazole, a US Food and Drug Administration–approved antifungal drug, inhibits the Hedgehog (HH) signaling pathway, a crucial driver of basal cell carcinoma (BCC) tumorigenesis, and reduces BCC growth in mice. We assessed the effect of itraconazole on the HH pathway and on tumor size in human BCC tumors.
Patients and Methods
Patients with ≥ one BCC tumor > 4 mm in diameter were enrolled onto two cohorts to receive oral itraconazole 200 mg twice per day for 1 month (cohort A) or 100 mg twice per day for an average of 2.3 months (cohort B). The primary end point was change in biomarkers: Ki67 tumor proliferation and HH activity (GLI1 mRNA). Secondary end points included change in tumor size in a subset of patients with multiple tumors.
Results
A total of 29 patients were enrolled, of whom 19 were treated with itraconazole. Itraconazole treatment was associated with two adverse events (grade 2 fatigue and grade 4 congestive heart failure). Itraconazole reduced cell proliferation by 45% (P = .04), HH pathway activity by 65% (P = .03), and reduced tumor area by 24% (95% CI, 18.2% to 30.0%). Of eight patients with multiple nonbiopsied tumors, four achieved partial response, and four had stable disease. Tumors from untreated control patients and from those previously treated with vismodegib showed no significant changes in proliferation or tumor size.
Conclusion
Itraconazole has anti-BCC activity in humans. These results provide the basis for larger trials of longer duration to measure the clinical efficacy of itraconazole, especially relative to other HH pathway inhibitors.
Introduction
Basal cell carcinoma (BCC) is the most commonly diagnosed human cancer, with approximately 2 million new cases in the United States every year.1 Patients affected by the rare heritable basal cell nevus (Gorlin) syndrome (Online Mendelian Inheritance in Man No. 109400) may develop hundreds to thousands of BCCs.2 Patients with basal cell nevus syndrome inherit one defective copy of the tumor suppressor gene PTCH1, which acts as a primary inhibitor of the Hedgehog (HH) signaling pathway.3–5 PTCH1 gene mutations and loss of the remaining wild-type allele also occur in sporadic BCC.3–5 Essentially all BCCs have malignant activation of the HH signaling pathway, which is commonly measured by the expression of a target gene encoding the GLI1 transcription factor.2–4 The recent US Food and Drug Administration (FDA) approval of vismodegib, an antagonist of the essential HH pathway component Smoothened (SMO), validates the effectiveness of HH pathway inhibition in the treatment of BCC.6 Vismodegib is approved for locally advanced (inoperable) or metastatic BCC, which comprises only 2% of all BCCs. A majority of BCCs can be treated by surgical excision, although surgery can lead to significant scarring and morbidity.5 Given the rising incidence of BCC and its costly treatment—one of the highest among Medicare recipients7—there is a large unmet clinical need for nonsurgical forms of treatment.8 Although some chemotherapeutic creams such as imiquimod and fluouracil are FDA approved, these topical options are effective only against the superficial subtype of BCC, which comprises only 30% of all BCCs.9,10 The frequent adverse effects (hair loss, weight loss, muscle cramps) of vismodegib preclude it as a viable treatment option for a majority of nonadvanced BCCs.6
We performed a screen of FDA-approved drugs and identified itraconazole, a widely used oral antifungal agent, as a potent HH pathway antagonist.11 Previously, we demonstrated that itraconazole suppresses autochthonous murine BCC carcinogenesis, induces tumor necrosis, and reduces GLI1 mRNA expression in mice.11 To assess the mechanism of action and clinical efficacy of itraconazole in human BCC, we performed an open-label, proof-of-concept phase II trial in two cohorts of patients with sporadic BCC. The primary goals of our two cohorts were to evaluate whether itraconazole-induced inhibition of HH pathway activity (GLI1 mRNA) could reduce tumor proliferation (Ki67) and tumor size in human BCC and to evaluate whether significant reductions in tumor size could be achieved with lower doses of itraconazole administered over a longer duration.
Patients and Methods
Patients and Treatments
We recruited patients with ≥ one BCC tumor > 4 mm (longest diameter), with no comorbidities and normal liver function tests within 1 year before enrollment. Those taking medications that might affect BCC tumors or the metabolism of itraconazole (eg, anticonvulsants, corticosteroids) and those unable to attend both initial biopsy and surgical excision at the same institution were excluded from the study. All patients had AST/ALT measured after 1 month of itraconazole.
We screened 67 patients for eligibility and enrolled 29 at two sites; 37 patients were excluded from enrollment because of their inability to have both biopsy and excision at the same site. Cohort A (Stanford University, Stanford, CA) enrolled 25 patients from April 2010 to December 2010, and cohort B (Universidad Católica de Chile, Santiago, Chile) enrolled four patients from July 2010 to September 2011 (CONSORT diagram; Fig 1). Only one patient met clinical diagnosis for basal cell nevus syndrome.
In cohort A, patients received itraconazole in 200-mg tablets orally twice per day between the time of biopsy and time of definitive excision (routinely 4 weeks). The primary goal of cohort A was to assess tumor biomarkers (Ki67 proliferation and HH pathway activity [GLI1 mRNA]) and tumor size change after 1 month of treatment. In cohort B, patients received 100-mg tablets orally twice per day. The primary goal of cohort B was to determine whether a lower itraconazole dose administered over a longer duration (mean, 2.3 months; range, 1 to 4 months) could still achieve clinically significant effects. Patients otherwise eligible but unwilling to take itraconazole were enrolled onto the control arm of the study and received no treatment. The parallel studies were approved by the respective institutional review boards.
Three patients from cohort A were previously treated with vismodegib and experienced progression during therapy, likely as a result of secondary resistance to vismodegib.12 Because itraconazole also antagonizes SMO, and little is known about how resistance to one drug may affect the efficacy of another SMO inhibitor, those previously treated with vismodegib were analyzed separately from vismodegib-naive patients. Therefore, we ultimately analyzed three discrete groups: one, patients who received no itraconazole; two, patients who received itraconazole without prior vismodegib treatment; and three, patients who received itraconazole with prior vismodegib treatment.
Tumor Biopsies and Biomarker Evaluations (cohort A)
At the time of enrollment, patients in cohort A had target BCC lesions (one or two of the most representative tumors) selected for biopsy. Biopsied tumors were paraffin embedded and stained for Ki67 to assess cell proliferation. Cells with positive nuclear staining (indicating actively proliferating cells) were counted by Flagship Biosciences (Flagstaff, AZ) and normalized to the total number of nuclei present in the BCC. Cell proliferation data presented here are expressed as percentage of cells with a positive signal. To assess HH pathway activity, fresh biopsy samples were flash frozen, placed in Trizol (Invitrogen, Carlsbad, CA), and homogenized using MP FastPrep 24 (MP Biomedicals, Solon, OH). Total RNA was purified with phase Lock Gels tubes (Eppendorf, Hamburg, Germany) and an RNA PureLink Micro Kit (Invitrogen). cDNA was synthesized with SuperScript III Reverse Transcriptase (Invitrogen). Real-time polymerase chain reaction was performed on a Bio-Rad iCycler using iQ SyberGreen Supermix (Bio-Rad, Hercules, CA). Fold change in GLI1 mRNA expression was measured using ΔΔCt analysis, with HPRT1 as the internal control gene and normal skin collected from patients with BCC as control samples for normalization of the BCC samples. Polymerase chain reaction primer sequences were:
•
GLI1 forward: 5′ GAAGTCATACTCACGCCTCGAA 3′
•
GLI1 reverse: 5′ CAGCCAGGGAGCTTACATACAT 3′
•
HPRT1 forward: 5′ GGTCAGGCAGTATAATCCAAAG 3′
•
HPRT1 reverse: 5′GGACTCCAGATGTTTCCAAAC 3′
In cases where the biopsy/excision had limited tumor volume, samples were prioritized for cell-proliferation analysis. No tumors were biopsied for biomarker analysis in cohort B, because its primary goal was to evaluate the effect of low-dose itraconazole on tumor size.
Tumor Size Measurements
In cohort A, 11 of 15 patients had only one BCC tumor. This target lesion was biopsied and excised for biomarker analysis. Target lesions were not assessed for tumor size change, because they were biopsied at baseline. Only four of 15 patients had ≥ one BCC tumor, and nontarget lesions (n = 42) were observed for tumor size change because these were not biopsied at baseline. Tumor area was assessed with calipers measuring longest perpendicular diameters before and after 1 month of itraconazole 200 mg twice per day. In contrast, all tumors from the four patients (n = 14 BCCs) in cohort B were assessed for tumor size change using calipers before and after treatment with itraconazole 200 mg per day (average duration, 2.3 months). Percent change in tumor area from both cohorts (eight patients total with 57 tumors) was calculated from date of enrollment to date of last clinical assessment.
For each patient measured for tumor area, validated BCC clinical response parameters were used per Skvara et al13 and defined as follows: complete response, no longer any visible evidence of a lesion consistent with BCC; partial response, although a BCC still remains, there is a visible decrease in size; and no response, the BCC has not visibly decreased in size. A dermatologist investigator who was blinded to treatment groups performed all clinical evaluations using photographs taken before and after treatment. We did not use RECIST criteria for solid tumors, because a majority of BCC lesions were < 10 mm in size, and tumor lesions were primarily assessed for biomarker changes.
Statistical Analysis
As an exploratory trial, we calculated that a minimum of 27 patients needed to be enrolled to detect a two-fold difference between the change in Ki67 in patients not treated versus treated with itraconazole (β, 0.80; two-sided α, 0.05). Nonparametric Mann-Whitney rank sum test was used for unpaired comparisons, and Wilcoxon signed rank test was used for paired comparisons. All P values reported are two sided.
Results
Patient Demographics
We enrolled 29 patients with a total of 101 BCC tumors; 19 patients with a total of 90 BCCs consented to treatment with itraconazole (cohort A, n = 15; cohort B, n = 4). At baseline, itraconazole-treated patients and control patients were similar in age, sex, BCC type, and location of BCC tumors (Table 1). Tumors appeared on classically sun-exposed regions of the body, including the face, neck, and trunk. Patients were predominantly older men (mean age, 60 years) with nodular BCC subtypes. Patients receiving itraconazole had, on average, almost 5× as many tumors at baseline compared with those not treated with itraconazole (P = .13). Average duration of observation/treatment was approximately 1 month among control patients and itraconazole-treated patients in cohort A (n = 76 tumors) and 2.3 months among itraconazole-treated patients in cohort B (n = 14 tumors). Three patients in cohort A were previously treated with vismodegib and experienced disease progression and had stopped vismodegib for ≥ 6 months before starting itraconazole.
| Characteristic | Control (n = 10) | Itraconazole (n = 19) | ||
|---|---|---|---|---|
| No. | % | No. | % | |
| Age at initial biopsy, years | ||||
| Average | 68.5 | 62.2 | ||
| Range | 53 to 81 | 44 to 85 | ||
| Sex | ||||
| Male | 8 | 80 | 15 | 79 |
| Female | 2 | 20 | 4 | 21 |
| Total No. of BCC tumors present | 11 | 90 | ||
| Average No. of BCC tumors per patient | 1.1 | 4.77 | ||
| BCC tumor type* | ||||
| Nodular | 6 | 43 | 21 | 50 |
| Superficial | 4 | 29 | 14 | 33 |
| Infiltrative | 2 | 14 | 5 | 12 |
| Micronodular | 2 | 14 | 2 | 5 |
| BCC tumor location | ||||
| Face | 6 | 55 | 35 | 39 |
| Back | 2 | 18 | 17 | 19 |
| Shoulder | 0 | 0 | 13 | 14 |
| Neck | 0 | 0 | 8 | 9 |
| Chest | 0 | 0 | 6 | 7 |
| Leg | 1 | 9 | 6 | 7 |
| Arm | 2 | 18 | 2 | 2 |
| Scalp | 0 | 0 | 2 | 2 |
| Ear | 0 | 0 | 1 | 3 |
| History of vismodegib treatment | 0 | 0 | 3 | |
| Average length of treatment, months | ||||
| Stanford patients (200 mg twice per day) | 1.1 | 1.0 | ||
| Chile patients (100 mg twice per day) | NA | 2.3 | ||
Abbreviations: BCC, basal cell carcinoma; NA, not applicable.
*
Includes only tumors that were biopsied.
Drug-Related Adverse Events
Two of 19 patients discontinued itraconazole because of previously described adverse effects associated with itraconazole. One grade 4 congestive heart failure occurred in a patient who had undiagnosed heart disease from prior adriamycin treatment for Hodgkin lymphoma 20 years ago (Fig 1). A second patient discontinued because of grade 2 fatigue. Other adverse effects were mild, and all adverse effects were reversible on drug discontinuation. No elevations in liver function testing (AST/ALT) were detected in any patient during treatment.
Biomarker Analysis (cohort A only)
A total of 63 biopsies from 22 of 25 enrolled patients in cohort A were available for biomarker analysis (Fig 1). We compared the change in Ki67 proliferation in biopsies taken at baseline and at excision 1 month later in itraconazole-treated patientss (20 BCCs) and untreated/control patients (12 BCCs). Itraconazole decreased cell proliferation by 35% in vismodegib-naive patients in unpaired analysis (P = .079; Figs 2A through 2C). Within patient comparisons of Ki67 activity from baseline to excision, itraconazole decreased cell proliferation by 45% in vismodegib-naive patients (n = 8; pairwise P = .04; Fig 2D). Control patients and those previously treated with vismodegib, by contrast, showed no significant changes in cell proliferation (Fig 2E).
For analysis of HH signaling pathway, a total of 24 biopsies were collected from itraconazole-treated patients and analyzed for GLI1 mRNA levels. In an unpaired analysis, itraconazole decreased GLI1 mRNA by 65% in tumors from vismodegib-naive patients compared with baseline (P = .028; Fig 3A). Examining only paired tumors from four patients (vismodegib naive), itraconazole decreased GLI1 mRNA by 45% in tumors after 1 month compared with baseline (Fig 3B). Tumors from patients with prior vismodegib treatment did not demonstrate a significant decrease in GLI1 mRNA expression. Other BCC clinical trials have also demonstrated no change in GLI1 mRNA expression in placebo-treated or control patients.14,15
Tumor Size Changes and Clinical Response (cohorts A and B)
Itraconazole reduced tumor size and promoted re-epithelialization in BCC tumors of eight of 29 vismodegib-naive patients (Fig 4). In cohort A, four patients had > one BCC tumor, and these nontarget lesions were observed for tumor size change, because these were not biopsied at baseline (n = 43). Tumor area was assessed with calipers measuring longest perpendicular diameters before and after 1 month of itraconazole 200 mg twice per day. In the four patients in cohort B, all 14 BCC tumors were assessed for tumor size change using calipers before and after treatment with itraconazole 100 mg twice per day (average duration, 2.3 months). None of cohort B tumors were biopsied for biomarker analysis, because the goal of cohort B was to assess a lower dose of itraconazole for a longer duration. Percent change in tumor area from both cohorts (eight patients total with 57 tumors) is shown in Figure 5. On average, tumors from vismodegib-naive patients decreased by 24% (95% CI, 18.2% to 30.0%) after treatment with itraconazole (Fig 5). Furthermore, average tumor reductions in patients from cohort B were comparable to those of cohort A (P = .435). This finding suggests that the alternate administration of itraconazole (lower doses over longer duration) can still achieve clinically significant reductions.
Despite the general reduction in size, none of the BCC tumors disappeared completely with itraconazole treatment after an average of 1.1 months (cohort A, n = 43 tumors) and 2.3 months (cohort B, n = 14 tumors). Four patients experienced partial response, and four had stable disease using previously described guidelines.16 In clinical assessments, neither control patients nor patients with a history of vismodegib treatment showed any changes in tumor size.
Discussion
In this proof-of-concept study, we have demonstrated the first off-label use, to our knowledge, of an FDA-approved drug for BCC treatment that targets HH pathway activity. Itraconazole can reduce BCC tumor size via inhibition of the HH signaling pathway after 1 month of treatment. These results provide the basis for larger trials of longer duration to measure the clinical efficacy of itraconazole.
As an exploratory phase II trial, the primary end point of this study was to determine whether itraconazole at commonly prescribed doses of 200 to 400 mg daily could reduce tumor proliferation and HH pathway in human BCCs after 1 month. Only four patients in cohort B were treated for > 1 month, and thus, we do not have results on the clinical anti-BCC efficacy of itraconazole over a longer treatment period. Furthermore, we cannot directly compare the short-term efficacy of itraconazole with that of vismodegib, the first FDA-approved HH inhibitor that showed a 40% response rate in patients with locally advanced BCC treated for > 10 months.6 Itraconazole seems to have less clinical utility compared with vismodegib as first-line treatment, because the half maximal inhibitory concentration of itraconazole is 100× less potent in vitro compared with vismodegib, and itraconazole reduces HH pathway by 65% after 1 month in contrast to a 90% reduction by vismodegib.15 Itraconazole may be effective as second-line therapy, because itraconazole acts on SMO at a site distinct from cyclopamine and vismodegib.11 As demonstrated by in vitro signaling assays,17 the efficacy of itraconazole is dose dependent, and future studies should examine whether higher doses of itraconazole administered over longer treatment periods can approach the efficacy seen with vismodegib and other SMO antagonists. However, chronic administration of itraconazole could also have additional adverse effects and toxicity not seen in this exploratory trial, although long-term treatment with 600 to 900 mg per day ranging from 3 to 16 months with manageable toxicities have been reported.18,19
Our study has several limitations. First, it was limited by sample size, because we enrolled only 29 patients; however, many patients had multiple tumors, and this study evaluated 101 BCCs. Second, all but one of the patients in this study had nonadvanced BCC, and none had metastatic disease; thus, our results cannot be compared with the 40% overall response rate seen with vismodegib in patients with advanced or metastatic BCC.6 Third, we only had three patients who experienced progression with vismodegib and did not perform sequencing analyses to determine the mechanism of vismodegib drug resistance. Thus, we could not directly test whether itraconazole could be a viable option as second-line treatment after failure of vismodegib. Fourth, we only assessed the short-term efficacy of itraconazole, and chronic administration is needed to compare the efficacy and toxicity of itraconazole relative to vismodegib. Future randomized controlled trials are needed to determine the efficacy of itraconazole in a broader range of patients with varying burdens of disease, a potential differential efficacy in vismodegib-resistant versus vismdoegib-naive tumors, and the possibility of whether a double anti-SMO attack would yield superior results. Our preclinical results suggest that a double anti-SMO inhibition reduces tumor growth more effectively than itraconazole or cyclopamine alone.11
Recently, combinatorial therapy with arsenic trioxide (ATO), FDA approved for acute promyelocytic leukemia, has been shown to be efficacious in murine BCC and vismodegib-resistant medullobloastoma.20 ATO acts as an HH antagonist by preventing ciliary trafficking and destabilizing GLI2, a transcription factor downstream of SMO.17 Combined treatment with itraconazole and ATO might prove particularly beneficial in BCC tumors resistant21 to SMO antagonists, such as vismodegib, that mimic and compete for binding with cyclopamine.20 Assuming vismodegib-resistant BCCs behave similarly to medulloblastoma,22,23 combined itraconazole-ATO therapy may overcome resistance resulting from SMO mutations and GLI2 amplifications, because itraconazole inhibits SMO through a mechanism distinct from cyclopamine,11 and ATO inhibits the GLI transcription factors. To this end, we have initiated a trial of combination itraconazole and ATO in patients with metastatic BCCs for whom vismodegib has failed (clinicaltrials.gov NCT01791894).
See accompanying editorial on page 720
Clinical trial information: NCT01108094.
Authors' Disclosures of Potential Conflicts of Interest
Although all authors completed the disclosure declaration, the following author(s) and/or an author's immediate family member(s) indicated a financial or other interest that is relevant to the subject matter under consideration in this article. Certain relationships marked with a “U” are those for which no compensation was received; those relationships marked with a “C” were compensated. For a detailed description of the disclosure categories, or for more information about ASCO's conflict of interest policy, please refer to the Author Disclosure Declaration and the Disclosures of Potential Conflicts of Interest section in Information for Contributors.
Employment or Leadership Position: None Consultant or Advisory Role: Jean Y. Tang, Genentech (C) Stock Ownership: None Honoraria: None Research Funding: None Expert Testimony: None Patents, Royalties, and Licenses: None Other Remuneration: None
References
1.
DL Miller, MA Weinstock: Nonmelanoma skin cancer in the United States: Incidence J Am Acad Dermatol 30: 774– 778,1994
2.
MR Gailani, SJ Bale, DJ Leffell, etal: Developmental defects in Gorlin syndrome related to a putative tumor suppressor gene on chromosome 9 Cell 69: 111– 117,1992
3.
H Hahn, C Wicking, PG Zaphiropoulous, etal: Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome Cell 85: 841– 851,1996
4.
RL Johnson, AL Rothman, J Xie, etal: Human homolog of patched, a candidate gene for the basal cell nevus syndrome Science 272: 1668– 1671,1996
5.
EH Epstein: Basal cell carcinomas: Attack of the hedgehog Nat Rev Cancer 8: 743– 754,2008
6.
A Sekulic, MR Migden, AE Oro, etal: Efficacy and safety of vismodegib in advanced basal-cell carcinoma N Engl J Med 366: 2171– 2179,2012
7.
TS Housman, SR Feldman, PM Williford, etal: Skin cancer is among the most costly of all cancers to treat for the Medicare population J Am Acad Dermatol 48: 425– 429,2003
8.
E de Vries, M Louwman, M Bastiaens, etal: Rapid and continuous increases in incidence rates of basal cell carcinoma in the southeast Netherlands since 1973 J Invest Dermatol 123: 634– 638,2004
9.
H Gollnick, CG Barona, RG Frank, etal: Recurrence rate of superficial basal cell carcinoma following treatment with imiquimod 5% cream: Conclusion of a 5-year long-term follow-up study in Europe Eur J Dermatol 18: 677– 682,2008
10.
K Gross, L Kircik, G Kricorian: 5% 5-fluorouracil cream for the treatment of small superficial basal cell carcinoma: Efficacy, tolerability, cosmetic outcome, and patient satisfaction Dermatol Surg 33: 433– 439,2007 discussion 440
11.
J Kim, JY Tang, R Gong, etal: Itraconazole, a commonly used antifungal that inhibits Hedgehog pathway activity and cancer growth Cancer Cell 17: 388– 399,2010
12.
RL Yauch, GJ Dijkgraaf, B Alicke, etal: Smoothened mutation confers resistance to a Hedgehog pathway inhibitor in medulloblastoma Science 326: 572– 574,2009
13.
H Skvara, F Kalthoff, JG Meingassner, etal: Topical treatment of Basal cell carcinomas in nevoid basal cell carcinoma syndrome with a smoothened inhibitor J Invest Dermatol 131: 1735– 1744,2011
14.
DD Von Hoff, PM LoRusso, CM Rudin, etal: Inhibition of the hedgehog pathway in advanced basal-cell carcinoma N Engl J Med 361: 1164– 1172,2009
15.
JY Tang, JM Mackay-Wiggan, M Aszterbaum, etal: Inhibiting the hedgehog pathway in patients with the basal-cell nevus syndrome N Engl J Med 366: 2180– 2188,2012
16.
GJ Dijkgraaf, B Alicke, L Weinmann, etal: Small molecule inhibition of GDC-0449 refractory smoothened mutants and downstream mechanisms of drug resistance Cancer Res 71: 435– 444,2011
17.
J Kim, JJ Lee, J Kim, etal: Arsenic antagonizes the Hedgehog pathway by preventing ciliary accumulation and reducing stability of the Gli2 transcriptional effector Proc Natl Acad Sci U S A 107: 13432– 13437,2010
18.
K Takagi, A Yoshida, T Yamauchi, etal: Successful treatment of Aspergillus spondylodiscitis with high-dose itraconazole in a patient with acute myelogenous leukemia Leukemia 15: 1670– 1671,2001
19.
PK Sharkey, MG Rinaldi, JF Dunn, etal: High-dose itraconazole in the treatment of severe mycoses Antimicrob Agents Chemother 35: 707– 713,1991
20.
J Kim, BT Aftab, JY Tang, etal: Itraconazole and arsenic trioxide inhibit hedgehog pathway activation and tumor growth associated with acquired resistance to smoothened antagonists Cancer Cell 23: 23– 34,2013
21.
AL Chang, AE Oro: Initial assessment of tumor regrowth after vismodegib in advanced basal cell carcinoma Arch Dermatol 148: 1324– 1325,2012
22.
CM Rudin, CL Hann, J Laterra, etal: Treatment of medulloblastoma with hedgehog pathway inhibitor GDC-0449 N Engl J Med 361: 1173– 1178,2009
23.
S Buonamici, J Williams, M Morrissey, etal: Interfering with resistance to smoothened antagonists by inhibition of the PI3K pathway in medulloblastoma Sci Transl Med 2: 51ra70,2010
Information & Authors
Information
Published In
Copyright
© 2014 by American Society of Clinical Oncology.
History
Published online: February 03, 2014
Published in print: March 10, 2014
Authors
Author Contributions
Conception and design: Philip A. Beachy, Jean Y. Tang
Financial support: Philip A. Beachy, Jean Y. Tang
Administrative support: Katrina Spaunhurst, Philip A. Beachy, Jean Y. Tang
Provision of study materials or patients: Jean Y. Tang
Collection and assembly of data: Daniel J. Kim, Katrina Spaunhurst, Javier Montoya, Rita Khodosh, Kalyani Chandra, Teresa Fu, Anita Gilliam, Monserrat Molgo, Philip A. Beachy, Jean Y. Tang
Data analysis and interpretation: Daniel J. Kim, James Kim, Katrina Spaunhurst, Philip A. Beachy, Jean Y. Tang
Manuscript writing: All authors
Final approval of manuscript: All authors
Disclosures
Authors' disclosures of potential conflicts of interest and author contributions are found at the end of this article.
Funding Information
Supported by the Stanford Clinical and Translational Science Institute (SPARK) and Damon Runyon Clinical Investigator Award (J.Y.T.).
Metrics & Citations
Metrics
Altmetric
Citations
Article Citation
Open-Label, Exploratory Phase II Trial of Oral Itraconazole for the Treatment of Basal Cell Carcinoma. JCO 32, 745-751(2014).
Download Citation
If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download.
For more information or tips please see 'Downloading to a citation manager' in the Help menu.
Download article citation data for:
Journal of Clinical Oncology 2014 32:8, 745-751
Journal of Clinical Oncology 2014 32:8, 745-751
View Options
View options
Get Access
Login options
Check if you have access through your login credentials or your institution to get full access on this article.
Personal login Institutional LoginPurchase Options
Purchase this article to get full access to it.
Subscribe
Subscribe to this Journal
Renew Your Subscription
Become a Member