Abstract
The epigenetic regulation of genes has long been recognized as one of the causes of prostate cancer (PCa) development and progression. Recent studies have shown that a number of microRNAs (miRNAs) are also epigenetically regulated in different types of cancers including PCa. In this study, we found that the DNA sequence of the promoters of miR-29a and miR-1256 are partly methylated in PCa cells, which leads to their lower expression both in PCa cells and in human tumor tissues compared with normal epithelial cells and normal human prostate tissues. By real-time PCR, Western Blot analysis and miRNA mimic and 3′-UTR-Luc transfection, we found that TRIM68 is a direct target of miR-29a and miR-1256 and that the downregulation of miR-29a and miR-1256 in PCa cells leads to increased expression of TRIM68 and PGK-1 in PCa cells and in human tumor tissue specimens. Interestingly, we found that a natural agent, isoflavone, could demethylate the methylation sites in the promoter sequence of miR-29a and miR-1256, leading to the upregulation of miR-29a and miR-1256 expression. The increased levels of miR-29a and miR-1256 by isoflavone treatment resulted in decreased expression of TRIM68 and PGK-1, which is mechanistically linked with inhibition of PCa cell growth and invasion. The selective demethylation activity of isoflavone on miR-29a and miR-1256 leading to the suppression of TRIM68 and PGK-1 expression is an important biological effect of isoflavone, suggesting that isoflavone could be a useful non-toxic demethylating agent for the prevention of PCa development and progression.
Keywords: :
Introduction
Prostate cancer (PCa) is the most common cancer in men in the US.Citation1 Epigenetic regulation of genes has long been recognized as one of the many causes of cancer development and progression in human tumor system including PCa.Citation2 The epigenetic regulation of specific genes in human cancer cells include DNA methylation and histone modifications, leading to the changes in the expression of genes without altering the DNA sequences. DNA methylation has been well studied for understanding the epigenetic mechanisms of gene regulation. The methylation of promoter sequences in the DNA causes epigenetic gene silencing through the obstruction of transcriptional activators in or near the promoter. Importantly, recent studies have shown that a number of microRNAs (miRNAs) are also epigenetically regulated in different types of cancers including PCa,Citation3-Citation5 which is directly responsible for the regulation of coding mRNAs. The methylation of DNA in the promoter sequence of miRNAs causes decreased expression of miRNA, leading to increased expression of their target mRNAs and proteins. This mechanism leads to aberrant expression of oncogenes, which is in part responsible for the development and progression of cancers including PCa.
In the past five years, miRNAs have received increased attention in cancer research. These small, non-coding RNAs could inhibit target gene expression by binding to the 3′ untranslated region (3′UTR) of target mRNA, resulting in either mRNA degradation or inhibition of translation. It is becoming well known that miRNAs participate in many normal biological processes; however, miRNAs also play critical roles in the pathophysiological processes including cancer development and progression. It has been found that aberrant miRNA expression is correlated with the occurrence, progression, and treatment outcome of cancers.Citation6,Citation7 The miRNAs could be oncogenic or tumor suppressive dependent on their regulatory effects on cancers. It is commonly accepted that some miRNAs, such as let-7, miR-29, miR-34, miR-122, miR-152 and miR-330, function as tumor suppressor.Citation8 The methylation in the DNA sequence of the promoter of these tumor suppressive miRNAs could result in the low expression of tumor suppressive miRNAs, leading to the development and progression of cancers. Therefore, targeting the methylation of DNA sequences in the promoter of miRNAs could be a novel approach to inhibit the development and progression of cancer including PCa.
Interestingly, recent studies have shown that several natural agents including isoflavone could demethylate DNA sequences in the promoters of genes or miRNAs, leading to increased expression of genes or miRNAs.Citation9,Citation10 We have previously reported that isoflavone could alter the miRNA expression profiles, leading to the inhibition of cancer cell growth, induction of apoptosis, reversal of epithelial-to-mesenchymal transition (EMT), and enhancement of efficacy of conventional cancer therapeutics.Citation11,Citation12 In this study, we investigated whether isoflavone could demethylate DNA sequences in the promoter of tumor suppressive miR-29a and other miRNAs and thus affect the expression of their target genes. We found that isoflavone could demethylate the DNA sequences of the methylated promoter of miR-29a and miR-1256, which led to the upregulation of miR-29a and miR-1256. Increased expression of miR-29a and miR-1256 induced by isoflavone resulted in the downregulation in the expression of their target genes TRIM68 and PGK-1, which led to the inhibition of PCa cell growth and invasion.
Results
The DNA sequences in the promoters of miR-29a and miR-1256 were methylated in PCa cells, leading to lower expression of miR-29a and miR-1256
It is well known that the promoter activity of a specific miRNA regulates the expression level of the miRNA. In the DNA sequences of the promoter of miR-29a and miR-1256, there is a lot of CpG site that could be methylated, leading to the downregulation of miR-29a and miR-1256 expression (). By Methylation450 assay, we found that the methylation index of miR-29a and miR-1256 promoters in PCa cell group was much higher than that in prostate epithelial cell group (), suggesting more methylation events happened in the promoters of miR-29a and miR-1256 in PCa cells compared with non-cancer cells (normal cells). To confirm whether the methylation could downregulate the expression of miR-29a and miR-1256, we conducted specific miRNA assays. We found that the expression of miR-29a and miR-1256 was significantly lower in C4–2B and LNCaP PCa cells compared with RWPE-1 prostate epithelial cells (). Moreover, we also found that lower expression of miR-29a and miR-1256 in the human prostate tumor tissues from patients with PCa compared with their adjunct normal prostate tissues (). These results suggest that increased methylation of miR-29a and miR-1256 promoters in PCa could lead to decreased expression of miR-29a and miR-1256.
Figure 1. The methylation of miR-29a and miR-1256 promoters leads to decreased expression of miR-29a and miR-1256. Computerized analysis showed that there are many CpG sites in the promoters of miR-29a (A) and miR-1256 (B). Real-time RT-PCR showed that the expressions of miR-29a and miR-1256 were significantly downregulated in PCa cells [(C) *p < 0.05; n = 3] and in human prostate tumor tissues [(D) n = 46] compared with normal prostate epithelial cells and normal human prostate tissues.
![Figure 1. The methylation of miR-29a and miR-1256 promoters leads to decreased expression of miR-29a and miR-1256. Computerized analysis showed that there are many CpG sites in the promoters of miR-29a (A) and miR-1256 (B). Real-time RT-PCR showed that the expressions of miR-29a and miR-1256 were significantly downregulated in PCa cells [(C) *p < 0.05; n = 3] and in human prostate tumor tissues [(D) n = 46] compared with normal prostate epithelial cells and normal human prostate tissues.](/cms/asset/c5040139-85f5-42ff-9ad4-40844ff48d25/kepi_a_10921236_f0001.gif)
Table 1. The methylation index of miR-29a and miR-1256 promoters in prostate cancer group and normal cells group measured by Methylation450 chip assay
Isoflavone increased the expression of miR-29a and miR-1256 by demethylating DNA sequences in the promoters of miR-29a and miR-1256
To explore the effects of isoflavone on methylation, we obtained the methylation profiles of C4–2B and LNCaP PCa cells treated with isoflavone and Aza-dC by conducting Methylation450 array assay. We found that both Aza-dC and isoflavone decreased the methylation level the DNA sequences in the promoters of miR-29a and miR-1256 (). We also conducted methylation specific PCR to confirm the data from Methylation450 array data. The results showed that Aza-dC and isoflavone partly inhibited the methylation of miR-29a and miR-1256 promoters (). By miRNA expression assay, we found that both Aza-dC and isoflavone significantly upregulated the expression of miR-29a and miR-1256 (), suggesting that both isoflavone and Aza-dC treatment leads to increased expression of miR-29a and miR-1256, which is mediated by demethylation of the DNA sequence in the promoters of miR-29a and miR-1256. However, we also observed differential effects of isoflavone and Aza-dC on the expression of miR-155 and miR-421, which are known as oncogenic miRNAs. The expression of miR-155 and miR-421 was increased by Aza-dC treatment and decreased by isoflavone treatment (), suggesting the inhibitory effects of isoflavone on the oncogenic miRNAs through non-demethylation related regulation.
Table 2. The methylation index of miR-29a and miR-1256 promoters altered by isoflavone (G2535) and Aza-dC in prostate cancer cells measured by Methylation450 chip assay
Figure 2. The effects of isoflavone on miR-29a and miR-1256 expression. Methylation specific PCR showed that isoflavone or Aza-dC treatments could partly demethylate the promoters of miR-29a and miR-1256 (A). Real-time RT-PCR showed increased expression of miR-29a (B) and miR-1256 (C) after isoflavone or Aza-dC treatment. However, isoflavone and Aza-dC had differential effects on the expression of miR-155 and miR-421 (D). (C, control; A, Aza-dC; Iso, isoflavone; M, methylation; U, unmethylation)
TRIM68 is a target of miR-29a and miR-1256 and was upregulated in PCa
By comparing computerized prediction of miRNA targets with mRNA microarray analysis, we found that TRIM68 could be a target of both miR-29a and miR-1256. miR-29a and miR-1256 could bind to 3′UTR of TRIM68 with high binding score (). To confirm whether miR-29a and miR-1256 could biologically bind to the 3′UTR of TRIM68, we co-transfected TRIM68 3′UTR-Luc reporter vector with miR-29a, miR-1256 or the negative control miRNA into LNCaP and C4–2B cells. We found that the luciferase activity was inhibited by the introduction of miR-29a or miR-1256 in C4–2B and LNCaP cells (), suggesting that miR-29a or miR-1256 did bind to the 3′UTR of TRIM68. Furthermore, using real-time RT-PCR and Western Blot analysis, we observed that miR-29a or miR-1256 transfection inhibited the expression of TRIM68 mRNA () and protein (), suggesting that TRIM68 is a target of both miR-29a and miR-1256. In addition, we also observed that miR-1256 transfection could inhibit the expression of PGK-1 (), which could be another target of miR-1256 that was also found through the computerized prediction of miRNA target analysis.
Figure 3. Targeting TRIM68 by miR-29a and miR-1256. Computerized analysis showed miR-29a and miR-1256 sequence alignment to the sequence of TRIM68 3′UTR (A). Co-transfection of TRIM68 3′UTR-Luc and miR-29a, miR-1256 mimic, or negative control miRNA showed that miR-29a and miR-1256 directly bond to the 3′UTR of TRIM68 (B). Transfection of miR-29a, miR-1256 mimic, or negative control miRNA into PCa cells caused downregulation of TRIM68 and PGK-1 at mRNA (C) and protein (D) levels. (Neg: negative control miRNA; 29a: miR-29a; 1256: miR-1256; *: p < 0.05, n = 3)
Since we found decreased expression of miR-29a and miR-1256 in PCa cells and in human prostate tumor tissues compared with normal prostate epithelial cells and tissues, we expected that PCa cells should have high expression of TRIM68 and PGK-1. Indeed, we found that the mRNA () and protein () expression of TRIM68 and PGK-1 were higher in PCa cells and human tumor tissues compared with normal cells or normal human prostate tissues. Our data was consistent with other investigators’ reports showing higher expression of TRIM68 and PGK-1 in PCa, which can be found in ONCOMINE database (www.oncomine.org).
Figure 4. The expression of TRIM68 and PGK-1. A significantly higher mRNA expression of TRIM68 and PGK-1 was observed in PCa cells [(A) *: p < 0.05; n = 3] and in human prostate tumor tissues [(B) n = 46] compared with normal prostate epithelial cells and normal human prostate tissues measured by real-time RT-PCR. A significantly higher expression of TRIM68 and PGK-1 proteins were also observed in PCa cells compared with normal prostate epithelial cells as assessed by Western Blot analysis (C).
![Figure 4. The expression of TRIM68 and PGK-1. A significantly higher mRNA expression of TRIM68 and PGK-1 was observed in PCa cells [(A) *: p < 0.05; n = 3] and in human prostate tumor tissues [(B) n = 46] compared with normal prostate epithelial cells and normal human prostate tissues measured by real-time RT-PCR. A significantly higher expression of TRIM68 and PGK-1 proteins were also observed in PCa cells compared with normal prostate epithelial cells as assessed by Western Blot analysis (C).](/cms/asset/acf5e1fa-4801-42cb-800a-93aec92c0116/kepi_a_10921236_f0004.gif)
Isoflavone inhibited the expression of TRIM68 and PGK-1 mediated through upregulation of miR-29a and miR-1256 expression
Interestingly, we found that isoflavone and Aza-dC significantly inhibited the expression of TRIM68 and PGK-1 at mRNA ( and ) and proteins () levels in C4–2B and LNCaP cells. These observations are consistent with our findings showing that isoflavone and Aza-dC significantly upregulated the expression of miR-29a and miR-1256 in C4–2B and LNCaP cells (). These results suggest that downregulation of TRIM68 and PGK-1 by isoflavone could be mediated by the upregulation of miR-29a and miR-1256, which directly target TRIM68 and PGK-1 though binding to the 3′UTR of TRIM68 and PGK-1.
Figure 5. TRIM68 and PGK-1 expression was altered by isoflavone and Aza-dC. (A and B) Real-time RT-PCR showed that the expression of TRIM68 (A) and PGK-1 (B) mRNA were significantly inhibited by isoflavone and Aza-dC treatment. (C and D) western blot analysis showed that the expression of TRIM68 (C) and PGK-1 (D) proteins were inhibited by isoflavone (D) and Aza-dC (C). (C, control; Iso, isoflavone; A, Aza-dC; *p < 0.05, n = 3)
Table 3. TRIM68 and PGK-1 mRNA expression altered by isoflavone (G2535) and Aza-dC measured by microarray
Isoflavone inhibited cell growth and invasion mediated through the upregulation of miR-29a and miR-1256, and downregulation of TRIM68 and PGK-1 expression
Transfection of C4–2B and LNCaP cells with miR-29a and miR-1256 mimic significantly inhibited the growth of C4–2B and LNCaP PCa cells (). Likewise, isoflavone treatment also showed similar growth inhibition of C4–2B and LNCaP cells (). More importantly, we found that isoflavone treatment and the transfection of miR-29a or miR-1256 mimic into PCa cells significantly suppressed the invasive activity of C4–2B and LNCaP cells (). These results clearly suggest that isoflavone could inhibit the growth of PCa cells as well as inhibit their invasive capacity, which is in part mediated through the upregulation of miR-29a and miR-1256 expression, and consequent downregulation of TRIM68 and PGK-1 expression in PCa cells. By Ingenuity Pathway analysis, we found that isoflavone treatment regulated the signal transduction in the TRIM68/AR and PGK-1 () signaling networks, which appears to be responsible for the inhibition of cancer cell growth and invasion.
Figure 6. Inhibition of cell growth and invasion by miR-29a, miR-1256 and isoflavone through TRIM68/AR and PGK-1 signaling. Transfection of miR-29a and miR-1256 mimic into PCa cells, and isoflavone treatment significantly inhibited cell growth (A) and invasion (B) of PCa cells (*: p < 0.05; n = 3). Microarray and Ingenuity Pathway analysis showed that isoflavone downregulated TRIM68/AR and PGK-1 signaling (C; Green: downregulated; Red: upregulated).
Discussion
The methylation of DNA sequences in the promoter of several tumor suppressive genes has been found to play critical roles in PCa development and progression. In recent years, emerging evidence has shown that the promoter DNA sequence of tumor suppressive miRNAs could be methylated in PCa cells, leading to the loss of expression of specific miRNAs. In this study, we found that there are many CpG sites in the DNA sequence of the promoters of miR-29a and miR-1256 and that higher level of methylation was present in the promoter region of miR-29a and miR-1256 in PCa cells compared with normal prostate epithelial cells. The methylation of miR-29a has been previously found in lymphoma.Citation13 The methylation of miR-29a resulted in lower expression of miR-29a, and consequently results in higher expression of its target gene Mcl-1, which leads to apoptosis blockade and tumor cell survival in lymphoma.Citation13 It was also found that the treatment of cells with demethylating agent Aza-dC led to the induction in the expression of miR-29a in pancreatic cancer cells, suggesting that the methylation of miR-29a in pancreatic cancer cells is responsible for the loss of miR-29a expression.Citation14 Our results are consistent with these reports, demonstrating that the DNA sequences in the promoter of miR-29a are partly methylated in PCa cells, resulting in lower expression of miR-29a compared with normal prostate epithelial cells.
The role of miR-29a has been investigated in various cancers showing that miR-29a functions as a tumor suppressor. Downregulation of miR-29a expression has been found in colorectal, gastric, and lung cancers, acute myeloid leukemia, and lymphoma.Citation13,Citation15-Citation18 Furthermore, a significant downregulation in the expression of miR-29a has been found to be correlated with short survival, more invasive phenotype, and early recurrence.Citation16-Citation18 Therefore, miR-29a is believed to play important roles in the inhibition of cancer development and progression and the loss of its expression is in part responsible for tumor development and progression. However, there is no report on the expression level of miR-29a in PCa cells, normal prostate epithelial cells, human PCa specimens or normal human prostate tissues. In this study, we found that miR-29a expression was significantly downregulated in PCa cell lines and in human prostate tumor tissues compared with normal prostate epithelial cells and tissues, suggesting that miR-29a also function as a tumor suppressor in PCa development and progression. The biological function of miR-1256 is unknown. We found that the expression level of miR-1256 was also lower in PCa cells and human prostate tumor tissues compared with normal cells and normal human prostate tissues, suggesting that miR-1256 may also function as a tumor suppressor.
Recently, the studies on tripartite motif (TRIM) proteins have shown that some members of the TRIM family function as important regulators of carcinogenesis.Citation19 The tripartite motif containing 68 (TRIM68) has been found to be significantly upregulated in prostate cancer tissues compared with normal prostate tissues.Citation20 TRIM68 could functionally interact with co-activators of androgen receptor (AR) and promote the transactivation of AR.Citation20 Knockdown of TRIM68 could decrease the secretion of PSA and inhibit PCa cell growth and colony-forming ability.Citation20 Consistent with other investigators’ report, we also found that the mRNA and protein expression of TRIM68 was significantly upregulated in PCa cells and human prostate tumor tissues, suggesting the oncogenic function of TRIM68 in prostate carcinogenesis. Importantly, we found that both miR-29a and miR-1256 directly targeted TRIM68 by binding to the 3′UTR of TRIM68, leading to the downregulation of TRIM68 expression.
Phosphoglycerate kinase 1 (PGK-1) is an important molecule involved in the process of glycolysis. Studies have found upregulation of PGK-1 in gastric, pancreatic and metastatic prostate cancers.Citation21-Citation23 Interestingly, the high expression of PGK-1 is significantly correlated with tumor progression, metastasis and multidrug resistance in various cancers.Citation21,Citation22,Citation24-Citation26 It has also been reported that the expression of PGK-1 in PCa cells could induce bone formationCitation27 and that cancer-associated fibroblasts, which showed strong expression of PGK-1, could promote PCa growth,Citation28 suggesting that PGK-1 plays important roles in PCa development, progression and bone metastasis. In addition, both PGK-1 and AR genes are located within Xqll-Xql3 region and PGK-1 short tandem repeat polymorphism linkage to AR was found in PCa.Citation29,Citation30 In our study, we found that the expression of PGK-1 was upregulated and the expression of miR-1256 was downregulated in PCa cells and in human prostate tumor tissues. Transfection of miR-1256 mimic into PCa cells inhibited the expression of PGK-1, suggesting that PGK-1 could be a target of miR-1256. Therefore, the strategies for upregulation of miR-29a and miR-1256 could lead to the inhibition of PCa development and progression, which in part could be due to downregulation of TRIM68/AR/PGK-1 signaling network. Since transfection strategies are not practically applied for human studies, we sought to investigate whether natural non-toxic agents could be useful for the upregulation of miRNAs and thereby inactivate their targets for the inhibition of PCa cell growth.
To that end, we investigated the role of isoflavone. Isoflavone has shown its inhibitory effects on PCa cells through the regulation of multiple signaling pathways.Citation31 Isoflavone has also shown to reverse the methylation status of several genes including BTG3, GSTP1, RASSF1A, EPH2, BRCA1, p16, RARβ and MGMT.Citation32-Citation35 Studies have also shown the regulatory effects of isoflavone genistein on the methylation of miR-221/222 and miR-145 in PCa cells.Citation36,Citation37 These findings suggest the demethylating function of isoflavone. In our study, we found that isoflavone could demethylate the methylated promoter of miR-29a and miR-1256 and, in turn, increased the expression of miR-29a and miR-1256. The upregulation of miR-29a and miR-1256 by isoflavone treatment inhibited the expression of their target genes, TRIM68 and PGK-1. These results demonstrate the epigenetic regulatory effect of isoflavone. It is important to note that isoflavone is not just a pan-demethylating agent like Aza-dC. Aza-dC treatment caused the upregulation of miR-155 and miR-421 through the demethylation effects; however, isoflavone treatment downregulated the expression of miR-155 and miR-421 which are oncogenic miRNAs.Citation38,Citation39 Therefore, isoflavone with its specific targeting effect on miR-29a and miR-1256 methylation could be a promising agent for the inhibition of PCa development and progression mediated through epigenetic regulation.
By upregulating miR-29a and miR-1256 expression, isoflavone significantly suppressed the expression of TRIM68 and PGK-1, leading to the inhibition of PCa cell growth and invasion. Other investigators have reported that downregulation of TRIM68 could inhibit the secretion of PSA and the growth of PCa cells by suppression of AR signaling.Citation20 We have previously reported that isoflavone could also inhibit AR signaling.Citation40 Therefore, the epigenetic regulation of miR-29a and miR-1256 by isoflavone could be one of the molecular mechanisms by which isoflavone regulates AR signaling and inhibits PCa growth. In addition, upregulated expression of PGK-1 in tumors has been correlated with metastatic phenotype of tumor.Citation22,Citation23,Citation25 Thus, downregulation of PGK-1 through epigenetic regulation by isoflavone could be another molecular mechanism by which isoflavone would be able to inhibit PCa invasion. However, more mechanistic studies are warranted. In conclusion, the epigenetic regulation of genes and miRNAs by isoflavone would make it a promising agent for the prevention of prostate cancer development and progression.
Materials and Methods
Cell lines, reagents and antibodies
LNCaP (ATCC, Manassas, VA), VCaP (ATCC), PC-3 (ATCC), C4–2B and ARCaPM (Novicure) prostate cancer (PCa) cells were maintained in RPMI 1640 (Invitrogen) or MCaP (for ARCaPM, Novicure) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 μg/ml streptomycin in a 5% CO2 atmosphere at 37°C. RWPE-1 (ATCC) and CRL2221 (ATCC) prostate epithelial cells were cultured in keratinocyte serum-free medium supplemented with 5 ng/ml of epidermal growth factor (EGF) and 50 μg/ml of bovine pituitary extract (Invitrogen). The cell lines have been tested and authenticated through the core facility Applied Genomics Technology Center at Wayne State University. The method used for testing was short tandem repeat (STR) profiling using the PowerPlex 16 System from Promega. Isoflavone mixture G2535 (70.5% genistein, 26.3% daidzein and 0.31% glycetein manufactured by Organic Technologies and obtained from NIH) was dissolved in DMSO to make a stock solution containing 50 mM genistein. The concentrations of isoflavone we described in this article all refer to the concentration of genistein in isoflavone mixture. 5-aza-2’-deoxycytidine (Aza-dC, Sigma) was dissolved in DMSO to make a stock solution of 10 mM. Anti-TRIM68 (Santa Cruz), anti-PGK-1 (Santa Cruz), anti-β-actin (Sigma) and anti-GAPDH (Sigma) primary antibodies were used for Western Blot analysis.
Methylation450K chip analysis
PCa cells were treated with 5 μM Aza-dC or 20 μM G2535. Control cells received 0.05% DMSO (solvent control). Fresh Aza-dC, G2535 and DMSO were administered everyday along with a change of culture medium. After 5 d of treatment, genomic DNA was isolated and purified by using the Wizard Genomic DNA Purification Kit (Promega). The purified DNA from each sample was preceded to bisulfate conversion using the EZ DNA Methylation-Gold Kit (Zymo Research, Irvine, CA). The converted DNA was then applied to the HumanMethylation450 BeadChip (Illumina, San Diego, CA). The Illumina Infinium 450K methylation files obtained from the Illumina iScan scanner were uploaded to GenomeStudio (V2011.1, Illumina) using the Methylation module. Data was normalized using the Controls Normalization method. Differentially methylated probes were identified using the Illumina Custom Error Model with Benjamini-Hochberg False Discovery Rate correction. A p-value was associated with every probe (Detection p-value) and probes were discarded if this Detection p-value was more than 0.05. All data analysis and statistical evaluation was assisted by Dr. Dyson.
Methylation-specific PCR
Cell treatment and DNA extraction were described above. After DNA extraction, 500 ng of genomic DNA was treated with bisulfite using the EZ DNA Methylation-Gold Kit (Zymo Research). The modified DNA was eluted with a final volume of 12 μl. Conventional PCR was performed using 100 ng modified DNA and ZymoTaq DNA Polymerase Kit (Zymo Research) in a thermocycle (Eppendorf) with initial 95°C 10 min and 40 cycles of 95°C 30 sec, 55°C 40 sec, and 72°C 60 sec. The PCR product was visualized in 2% agarose gel with ethidium bromide staining. The primers were designed by using Methylation Primer Express (Applied Biosystems). The sequences of primers used were: 29aM-2-F: TTAAGAATTATATTATGACGGC; 29aM-2-R: ATATCGCTTCCGAAATAA; 29aU-2-F: ATATTAAGAATTATATTATGATGGT; 29aU-2-R: CTAATATCACTTCCAAAATAA; 1256M-2-F: GGCGCGATTTTAGTTTATC; 1256M-2-R: TTTAATTACCAACCGAATACG; 1256U-2-F: AGTGGTGTGATTTTAGTTTATT; 1256U-2-R: TTTAATTACCAACCAAATACAATA.
Microarray analysis of isoflavone and Aza-dC treated PCa cells
C4–2B and LNCaP cells were treated with 20 μM G2535 or 5 μM Aza-dC for 5 d as described earlier. Total RNA from each sample was isolated by using RNeasy Mini Kit and RNase-free DNase Set (QIAGEN) according to the manufacture's protocols. RNA purity and integrity were evaluated by microfluidics analysis using Agilent 2100 bioanalyzer (Agilent Technologies). The samples were processed for cDNA synthesis, transcriptional cRNA labeling, and hybridization to HumanHT-12 v4 BeadChip (Illumina) following standard protocol from Illumina. The HumanHT-12 v4 BeadChip provides coverage for more then 47,000 transcripts and known splice variants across the human transcriptome. The raw data of gene expression from scanning was normalized and compared by using GenomeStudio (Illumina) with gene expression module. The fold changes were computed between the different groups. The gene expression data was also integrated with methylation data to compare the methylation status and gene expression status using GenomeStudio.
Total RNA extraction, miRNA and mRNA detection
Total RNA was extracted by using the miRNeasy Mini Kit and RNase-free DNase Set (QIAGEN) following the protocol provided by the manufacturer. The expression level of miR-29a, miR-1256, miR-155, and miR-421 in isoflavone and Aza-dC treated C4–2B and LNCaP cells was analyzed by using TaqMan MicroRNA Assay Kit (Applied Biosystems) following manufacturer’s protocol. Briefly, total RNA from each sample was subjected to reverse transcription with a specific miRNA primer (Applied Biosystems). Real-time PCR reactions were then performed in StepOnePlus (Applied Biosystems). The total RNA extracted from paraffin-embedded tissues obtained from PCa patients was also subjected to miR-29a and miR-1256 assay using Universal cDNA Synthesis Kit (Exiqon), specific LNA™ PCR primer set (Exiqon), and SYBR Green RT-PCR Reagents (Applied biosystems). The PCR program was initiated by 10 min at 95°C before 40 thermal cycles, each of 15 sec at 95°C and 1 min at 60°C. Data were analyzed according to the comparative Ct method and were normalized by RNU48 and RNU44 expression in each sample. The expression level of miRNA was statistically evaluated by Student’s t-Test using GraphPad StatMate software (GraphPad Software Inc.).
The expression level of TRIM68 and PGK-1 in isoflavone and Aza-dC treated C4–2B and LNCaP cells, and in the human tissues obtained from PCa patients was analyzed by real-time RT-PCR using High Capacity RNA-to-cDNA Kit and SYBR Green Master Mixture from Applied Biosystems. The sequences of primers used were: TRIM68-F: GGAGCAAATCTTGGAGCTTG; TRIM68-R: TCCTCAGACACGATGAGACG; PGK1-F: CTGTGGGGGTATTTGAATGG; and PGK1-R: CTTCCAGGAGCTCCAAACTG. The PCR was initiated by 10 min at 95°C before 40 thermal cycles, each of 15 sec at 95°C and 1 min at 60°C. Data were analyzed according to the comparative Ct method and were normalized by GAPDH expression in each sample.
Western blot analysis
Whole cell lysates from isoflavone and Aza-dC treated C4–2N and LNCaP cells were subjected to standard Western Blot analysis as described previously.Citation41 The signal was then detected using the chemiluminescent detection system (PIERCE). The signal of Western Blot was scanned and quantified by using AlphaEaseFC software (Alpha Innotech). The signal ratio of each protein over loading control was calculated by standardizing the ratios of each control to the unit value.
Re-expression of miR-29a and miR-1246 in PCa cells
C4–2B and LNCaP cells were seeded in 6 well plates and transfected with miR-29a mimic, miR-1256 mimic, or miRNA negative control (Ambion) at a final concentration of 20 nM using DharmaFact Transfection Reagent (Dharmacon). After 3 d of transfection, the cells were passaged and transfected repeatedly with the miRNAs for three more days. Total RNA from each sample was then extracted and the RNA was subjected to RT-PCR as described earlier. Total proteins from each sample were also extracted and subject to Western Blot analysis as described earlier. The C4–2B and LNCaP cells transfected with miR-29a and miR-1256 were also subjected to cell growth and invasion assays.
Cell growth assay by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)
C4–2B and LNCaP cells transfected with miR-29a, miR-1256, or miRNA negative control were seeded in 96-well plates. After 48 h of culture, the cells were subjected to MTT assay as described previously.Citation41 The growth inhibition of C4–2B and LNCaP cells after miRNA transfection was statistically evaluated by Student’s t-test using GraphPad StatMate software (GraphPad Software Inc.).
Invasion assay
The invasive capacity of C4–2B and LNCaP cells with miR-29a, miR-1256, or miRNA negative control transfection was assessed by using BD BioCoat Tumor Invasion Assay System (BD Biosciences) according to the manufacturer’s protocol with modification. Briefly, the miRNA transfected C4–2B and LNCaP cells with serum free medium were seeded into the upper chamber of the system. Bottom wells in the system were filled with complete medium. After 18 h of incubation, the cells in the upper chamber were removed, and the cells, which invaded through matrigel matrix membrane, were stained with 4 μg/ml Calcein AM in Hanks buffered saline at 37°C for one hour. Then, the solution was removed and trypsin was used to collect the invaded cells. After incubation for 5 min, the fluorescence of invaded cells in bottom chamber was read in an ULTRA Multifunctional Microplate Reader (TECAN) at excitation/emission wavelengths of 530/590 nm. The significance of difference between samples was statistically evaluated by Student’s t-Test using GraphPad StatMate software (GraphPad Software Inc.).
Luciferase activity assay for confirming miRNA binding to target 3′UTR
C4–2B and LNCaP cells were seeded in 96-well plates and incubated for 24 h. The cells were co-transfected with TRIM68 3′UTR luciferase vector (GeneCopoeia) and miR-29a, miR-1256, or miRNA negative control using DharmaFECT Duo Transfection Reagent (Dharmacon). The vector includes TRIM68 3′ UTR target sequence fused downstream to a firefly luciferase. The vector also contains renilla luciferase as internal control for signal normalization. After 48 h of transfection, firefly and renilla luciferase activities were assayed using Luc-Pair miR Luciferase Assay (GeneCopoeia) according to the manufacturer’s protocol. The renilla luciferase activity was used as a control when calculation for the miRNA 3′UTR binding was assessed. The significance of difference between samples was statistically evaluated by Student’s t-test using GraphPad StatMate software (GraphPad Software Inc.).
Patients and prostate tissue specimen collection
After obtaining institutional review board approval, retrospective archival pre-treatment PCa tissues and matched adjacent normal tissues were obtained from the Biospecimen Core of Karmanos Cancer Institute (KCI) collected from patients who underwent radical prostatectomy from 2004–2010 at KCI. Total RNA was extracted following our previously published procedures.Citation42
Acknowledgments
Support was provided by National Cancer Institute, NIH (5R01CA083695 and 5R01CA108535 to FHS). We also thank Guido and Puschelberg Foundation for their generous contribution for the completion of this study.
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
References
- Siegel R, Naishadham D, Jemal A. Cancer statistics, 2012. CA Cancer J Clin 2012; 62:10 - 29; http://dx.doi.org/10.3322/caac.20138; PMID: 22237781
- Jerónimo C, Bastian PJ, Bjartell A, Carbone GM, Catto JW, Clark SJ, et al. Epigenetics in prostate cancer: biologic and clinical relevance. Eur Urol 2011; 60:753 - 66; http://dx.doi.org/10.1016/j.eururo.2011.06.035; PMID: 21719191
- Formosa A, Lena AM, Markert EK, Cortelli S, Miano R, Mauriello A, et al. DNA methylation silences miR-132 in prostate cancer. Oncogene 2012; http://dx.doi.org/10.1038/onc.2012.14; PMID: 22310291
- Agirre X, Martínez-Climent JA, Odero MD, Prósper F. Epigenetic regulation of miRNA genes in acute leukemia. Leukemia 2012; 26:395 - 403; http://dx.doi.org/10.1038/leu.2011.344; PMID: 22143672
- Lopez-Serra P, Esteller M. DNA methylation-associated silencing of tumor-suppressor microRNAs in cancer. Oncogene 2012; 31:1609 - 22; http://dx.doi.org/10.1038/onc.2011.354; PMID: 21860412
- Wu WK, Law PT, Lee CW, Cho CH, Fan D, Wu K, et al. MicroRNA in colorectal cancer: from benchtop to bedside. Carcinogenesis 2011; 32:247 - 53; http://dx.doi.org/10.1093/carcin/bgq243; PMID: 21081475
- Li Y, Kong D, Wang Z, Sarkar FH. Regulation of microRNAs by natural agents: an emerging field in chemoprevention and chemotherapy research. Pharm Res 2010; 27:1027 - 41; http://dx.doi.org/10.1007/s11095-010-0105-y; PMID: 20306121
- Kasinski AL, Slack FJ. Epigenetics and genetics. MicroRNAs en route to the clinic: progress in validating and targeting microRNAs for cancer therapy. Nat Rev Cancer 2011; 11:849 - 64; http://dx.doi.org/10.1038/nrc3166; PMID: 22113163
- Huang J, Plass C, Gerhauser C. Cancer chemoprevention by targeting the epigenome. Curr Drug Targets 2011; 12:1925 - 56; http://dx.doi.org/10.2174/138945011798184155; PMID: 21158707
- Rabiau N, Trraf HK, Adjakly M, Bosviel R, Guy L, Fontana L, et al. miRNAs differentially expressed in prostate cancer cell lines after soy treatment. In Vivo 2011; 25:917 - 21; PMID: 22021684
- Li Y, VandenBoom TG 2nd, Kong D, Wang Z, Ali S, Philip PA, et al. Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. Cancer Res 2009; 69:6704 - 12; http://dx.doi.org/10.1158/0008-5472.CAN-09-1298; PMID: 19654291
- Li Y, Vandenboom TG 2nd, Wang Z, Kong D, Ali S, Philip PA, et al. miR-146a suppresses invasion of pancreatic cancer cells. Cancer Res 2010; 70:1486 - 95; http://dx.doi.org/10.1158/0008-5472.CAN-09-2792; PMID: 20124483
- Desjobert C, Renalier MH, Bergalet J, Dejean E, Joseph N, Kruczynski A, et al. MiR-29a down-regulation in ALK-positive anaplastic large cell lymphomas contributes to apoptosis blockade through MCL-1 overexpression. Blood 2011; 117:6627 - 37; http://dx.doi.org/10.1182/blood-2010-09-301994; PMID: 21471522
- Lee KH, Lotterman C, Karikari C, Omura N, Feldmann G, Habbe N, et al. Epigenetic silencing of MicroRNA miR-107 regulates cyclin-dependent kinase 6 expression in pancreatic cancer. Pancreatology 2009; 9:293 - 301; http://dx.doi.org/10.1159/000186051; PMID: 19407485
- Cui Y, Su WY, Xing J, Wang YC, Wang P, Chen XY, et al. MiR-29a inhibits cell proliferation and induces cell cycle arrest through the downregulation of p42.3 in human gastric cancer. PLoS One 2011; 6:e25872; http://dx.doi.org/10.1371/journal.pone.0025872; PMID: 21998710
- Zhao JJ, Lin J, Lwin T, Yang H, Guo J, Kong W, et al. microRNA expression profile and identification of miR-29 as a prognostic marker and pathogenetic factor by targeting CDK6 in mantle cell lymphoma. Blood 2010; 115:2630 - 9; http://dx.doi.org/10.1182/blood-2009-09-243147; PMID: 20086245
- Muniyappa MK, Dowling P, Henry M, Meleady P, Doolan P, Gammell P, et al. MiRNA-29a regulates the expression of numerous proteins and reduces the invasiveness and proliferation of human carcinoma cell lines. Eur J Cancer 2009; 45:3104 - 18; http://dx.doi.org/10.1016/j.ejca.2009.09.014; PMID: 19818597
- Kuo TY, Hsi E, Yang IP, Tsai PC, Wang JY, Juo SH. Computational analysis of mRNA expression profiles identifies microRNA-29a/c as predictor of colorectal cancer early recurrence. PLoS One 2012; 7:e31587; http://dx.doi.org/10.1371/journal.pone.0031587; PMID: 22348113
- Hatakeyama S. TRIM proteins and cancer. Nat Rev Cancer 2011; 11:792 - 804; http://dx.doi.org/10.1038/nrc3139; PMID: 21979307
- Miyajima N, Maruyama S, Bohgaki M, Kano S, Shigemura M, Shinohara N, et al. TRIM68 regulates ligand-dependent transcription of androgen receptor in prostate cancer cells. Cancer Res 2008; 68:3486 - 94; http://dx.doi.org/10.1158/0008-5472.CAN-07-6059; PMID: 18451177
- Ai J, Huang H, Lv X, Tang Z, Chen M, Chen T, et al. FLNA and PGK1 are two potential markers for progression in hepatocellular carcinoma. Cell Physiol Biochem 2011; 27:207 - 16; http://dx.doi.org/10.1159/000327946; PMID: 21471709
- Zieker D, Königsrainer I, Traub F, Nieselt K, Knapp B, Schillinger C, et al. PGK1 a potential marker for peritoneal dissemination in gastric cancer. Cell Physiol Biochem 2008; 21:429 - 36; http://dx.doi.org/10.1159/000129635; PMID: 18453750
- LaTulippe E, Satagopan J, Smith A, Scher H, Scardino P, Reuter V, et al. Comprehensive gene expression analysis of prostate cancer reveals distinct transcriptional programs associated with metastatic disease. Cancer Res 2002; 62:4499 - 506; PMID: 12154061
- Li M, Zhang B, Sun B, Wang X, Ban X, Sun T, et al. A novel function for vimentin: the potential biomarker for predicting melanoma hematogenous metastasis. J Exp Clin Cancer Res 2010; 29:109; http://dx.doi.org/10.1186/1756-9966-29-109; PMID: 20701774
- Zieker D, Königsrainer I, Weinreich J, Beckert S, Glatzle J, Nieselt K, et al. Phosphoglycerate kinase 1 promoting tumor progression and metastasis in gastric cancer - detected in a tumor mouse model using positron emission tomography/magnetic resonance imaging. Cell Physiol Biochem 2010; 26:147 - 54; http://dx.doi.org/10.1159/000320545; PMID: 20798498
- Duan Z, Lamendola DE, Yusuf RZ, Penson RT, Preffer FI, Seiden MV. Overexpression of human phosphoglycerate kinase 1 (PGK1) induces a multidrug resistance phenotype. Anticancer Res 2002; 22:1933 - 41; PMID: 12174867
- Jung Y, Shiozawa Y, Wang J, Wang J, Wang Z, Pedersen EA, et al. Expression of PGK1 by prostate cancer cells induces bone formation. Mol Cancer Res 2009; 7:1595 - 604; http://dx.doi.org/10.1158/1541-7786.MCR-09-0072; PMID: 19825988
- Wang J, Ying G, Wang J, Jung Y, Lu J, Zhu J, et al. Characterization of phosphoglycerate kinase-1 expression of stromal cells derived from tumor microenvironment in prostate cancer progression. Cancer Res 2010; 70:471 - 80; http://dx.doi.org/10.1158/0008-5472.CAN-09-2863; PMID: 20068185
- Tie J, Serizawa Y, Oshida S, Usami R, Yoshida Y. Short tandem repeat polymorphism in the flanking region of the human phosphoglycerate kinase gene in a Japanese population. Hum Biol 2006; 78:243 - 7; http://dx.doi.org/10.1353/hub.2006.0039; PMID: 17036931
- Riley DE, Krieger JN. Short tandem repeat polymorphism linkage to the androgen receptor gene in prostate carcinoma. Cancer 2001; 92:2603 - 8; http://dx.doi.org/10.1002/1097-0142(20011115)92:10<2603::AID-CNCR1613>3.0.CO;2-4; PMID: 11745195
- Sarkar FH, Li Y. Harnessing the fruits of nature for the development of multi-targeted cancer therapeutics. Cancer Treat Rev 2009; 35:597 - 607; http://dx.doi.org/10.1016/j.ctrv.2009.07.001; PMID: 19660870
- Vardi A, Bosviel R, Rabiau N, Adjakly M, Satih S, Dechelotte P, et al. Soy phytoestrogens modify DNA methylation of GSTP1, RASSF1A, EPH2 and BRCA1 promoter in prostate cancer cells. In Vivo 2010; 24:393 - 400; PMID: 20668305
- Majid S, Dar AA, Shahryari V, Hirata H, Ahmad A, Saini S, et al. Genistein reverses hypermethylation and induces active histone modifications in tumor suppressor gene B-Cell translocation gene 3 in prostate cancer. Cancer 2010; 116:66 - 76; PMID: 19885928
- Kikuno N, Shiina H, Urakami S, Kawamoto K, Hirata H, Tanaka Y, et al. Genistein mediated histone acetylation and demethylation activates tumor suppressor genes in prostate cancer cells. Int J Cancer 2008; 123:552 - 60; http://dx.doi.org/10.1002/ijc.23590; PMID: 18431742
- Fang MZ, Chen D, Sun Y, Jin Z, Christman JK, Yang CS. Reversal of hypermethylation and reactivation of p16INK4a, RARbeta, and MGMT genes by genistein and other isoflavones from soy. Clin Cancer Res 2005; 11:7033 - 41; http://dx.doi.org/10.1158/1078-0432.CCR-05-0406; PMID: 16203797
- Chen Y, Zaman MS, Deng G, Majid S, Saini S, Liu J, et al. MicroRNAs 221/222 and genistein-mediated regulation of ARHI tumor suppressor gene in prostate cancer. Cancer Prev Res (Phila) 2011; 4:76 - 86; http://dx.doi.org/10.1158/1940-6207.CAPR-10-0167; PMID: 21071579
- Zaman MS, Chen Y, Deng G, Shahryari V, Suh SO, Saini S, et al. The functional significance of microRNA-145 in prostate cancer. Br J Cancer 2010; 103:256 - 64; http://dx.doi.org/10.1038/sj.bjc.6605742; PMID: 20588276
- Chang S, Wang RH, Akagi K, Kim KA, Martin BK, Cavallone L, et al, Kathleen Cuningham Foundation Consortium for Research into Familial Breast Cancer (kConFab). Tumor suppressor BRCA1 epigenetically controls oncogenic microRNA-155. Nat Med 2011; 17:1275 - 82; http://dx.doi.org/10.1038/nm.2459; PMID: 21946536
- Zhong XY, Yu JH, Zhang WG, Wang ZD, Dong Q, Tai S, et al. MicroRNA-421 functions as an oncogenic miRNA in biliary tract cancer through down-regulating farnesoid X receptor expression. Gene 2012; 493:44 - 51; http://dx.doi.org/10.1016/j.gene.2011.11.028; PMID: 22146319
- Li Y, Wang Z, Kong D, Li R, Sarkar SH, Sarkar FH. Regulation of Akt/FOXO3a/GSK-3beta/AR signaling network by isoflavone in prostate cancer cells. J Biol Chem 2008; 283:27707 - 16; http://dx.doi.org/10.1074/jbc.M802759200; PMID: 18687691
- Li Y, Ahmed F, Ali S, Philip PA, Kucuk O, Sarkar FH. Inactivation of nuclear factor kappaB by soy isoflavone genistein contributes to increased apoptosis induced by chemotherapeutic agents in human cancer cells. Cancer Res 2005; 65:6934 - 42; http://dx.doi.org/10.1158/0008-5472.CAN-04-4604; PMID: 16061678
- Kong D, Heath E, Chen W, Cher ML, Powell I, Heilbrun L, et al. Loss of let-7 up-regulates EZH2 in prostate cancer consistent with the acquisition of cancer stem cell signatures that are attenuated by BR-DIM. PLoS One 2012; 7:e33729; http://dx.doi.org/10.1371/journal.pone.0033729; PMID: 22442719