Skip to main content
Intended for healthcare professionals
Open access
Research article
First published online April 26, 2017

Curcumin increases the sensitivity of Paclitaxel-resistant NSCLC cells to Paclitaxel through microRNA-30c-mediated MTA1 reduction

Yimin Lu [email protected], Jun Wang, Lei Liu, Lequn Yu, Nian Zhao, Xingju Zhou, and Xudong LuView all authors and affiliations
All Articles
https://doi.org/10.1177/1010428317698353

Abstract

Non-small-cell lung cancer is one of the most lethal cancers in the worldwide. Although Paclitaxel-based combinational therapies have long been used as a standard treatment in aggressive non-small-cell lung cancers, Paclitaxel resistance emerges as a major clinical problem. It has been demonstrated that Curcumin from Curcuma longa as a traditional Chinese medicine can inhibit cancer cell proliferation. However, the role of Curcumin in Paclitaxel-resistant non-small-cell lung cancer cells is not clear. In this study, we investigated the effect of Curcumin on the Paclitaxel-resistant non-small-cell lung cancer cells and found that Curcumin treatment markedly increased the sensitivity of Paclitaxel-resistant non-small-cell lung cancer cells to Paclitaxel. Mechanically, the study revealed that Curcumin could reduce the expression of metastasis-associated gene 1 (MTA1) gene through upregulation of microRNA-30c in Paclitaxel-resistant non-small-cell lung cancer cells. During the course, MTA1 reduction sensitized Paclitaxel-resistant non-small-cell lung cancer cells and enhanced the effect of Paclitaxel. Taken together, our studies indicate that Curcumin increases the sensitivity of Paclitaxel-resistant non-small-cell lung cancer cells to Paclitaxel through microRNA-30c-mediated MTA1 reduction. Curcumin might be a potential adjuvant for non-small-cell lung cancer patients during Paclitaxel treatment.

Introduction

Non-small-cell lung cancer (NSCLC) is one of the most aggressive cancers around the world with high mortality and occurrence. Despite improvements in chemotherapy, radiotherapy, and surgery, the prognosis of NSCLC still remains poor.1 Paclitaxel-based combinational chemotherapies exhibit a better curative effect for NSCLC patients.2,3 However, the resistance of NSCLC cells to Paclitaxel continues to be a major problem in clinic.4,5
Curcumin is an active phenolic compound extracted from the rhizome of the plant “Curcuma longa” as a traditional Chinese medicine. Extensive studies have revealed various biological functions of Curcumin.6–10 Reportedly, Curcumin is able to attenuate cancer cell proliferation and promotes apoptosis in vivo and in vitro.11–14 As an anti-cancer agent, Curcumin has been demonstrated to regulate transcriptional factors, signaling molecules, and microRNAs (miRNAs), such as signal transducer and activator of transcription 3 (STAT3), activation protein 1 (AP-1), Forkhead box O1 (FOXO1), nuclear factor kappa B (NF-κB), Akt, reactive oxygen species (ROS), miR-208, and miR-21.14–18 Our current study revealed that Curcumin could increase the sensitivity of Paclitaxel-resistant NSCLC cells to Paclitaxel in vitro. Further studies need to be done to explore the potential mechanism by which Curcumin enhances the sensitivity of Paclitaxel-resistant NSCLC cells to Paclitaxel.
Metastasis-associated gene 1 (MTA1) is ubiquitously expressed protein that markedly increases metastasis and aggressiveness of human cancers such as malignant pleural mesothelioma (MPM), colorectal cancer, hepatocellular carcinoma, gastric cancer, and prostate cancer.19–23 MTA1 has been reported to be upregulated in NSCLC and be involved in cancer cell growth.24,25 However, MTA1 expression can be downregulated as a target gene by drug-induced microRNA, and the reduction of MTA1 can inhibit the proliferation of cancer cells.26,27 Therefore, in this study, the role of MTA1 in Curcumin-enhanced sensitivity of Paclitaxel-resistant NSCLC cells to Paclitaxel and its upstream regulation by microRNA were explored subsequently.

Materials and methods

Cell culture

NSCLC cell lines of A549 and H460 (ATCC, Manassas, VA, USA) was cultured in RPMI 1640 medium with 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA) and penicillin (100 U/mL). Cells were cultured at 37°C with 5% CO2. Paclitaxel-resistant NSCLC cell lines A549 and H460 were generated using previously described protocols.28,29 HEK293T cells were provided by American Type Culture Collection (ATCC) and maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS (vol/vol), 100 µg/mL penicillin G, and 100 µg/mL streptomycin.

Generation of overexpression plasmid

The plasmid of pcDNA3.1/MTA1 was constructed by inserting the Open Reading Frame (ORF) of human MTA1 complementary DNA (cDNA) into the mammalian expression plasmid of pcDNA3.1. The MTA1 gene was amplified by polymerase chain reaction (PCR) from cDNA of normal human alveolar epithelial cells. Both PCR products and pcDNA3.1 vector were further digested with the two restriction enzymes of Hind III and BamH I and then ligated with T4 DNA ligase.

miRNA mimic and locked nucleic acid-anti-miRNA synthesis

The miR-30c-5p mimic, negative control mimic, and mutant miR-30c-5p mimic were purchased from GenePharma (Shanghai, China). Locked nucleic acid (LNA)-anti-miR-30c-5p and negative control LNA were purchased from Exiqon (Vedbæk, Denmark).

Short interfering RNA synthesis

To silence human MTA1 gene, a short interfering RNA (siRNA) sequence (GGGAGGATTTCTTCTTCTATTCT) against human MTA1 messenger RNA (mRNA) was designed with siDirect (http://sidirect2.rnai.jp/) and synthesized by GenePharma. Meanwhile, a universal negative control siRNA (ATTCTTGACGTGTTACTGTTGTC) was also produced by GenePharma.

3′-untranslated region luciferase reporter construction and luciferase assays

The plasmid of pGL3-Promoter/wild-type (WT)-MTA1 (pGL3-Promoter/WT-MTA1) was constructed by inserting the 460 kb 3′-untranslated region (UTR) of human MTA1 mRNA into pGL3-Promoter vector at the Xba I restriction enzyme site. Mutation of MTA1 3′-UTR was introduced into the miRNA-binding site by the QuikChange Mutagenesis Kit (TaKaRa, Kusatsu, Japan), and the plasmid of pGL3-Promoter/mutant-MTA1 was constructed successfully. For WT or mutant MTA1 3′-UTR reporter assay, HEK293T cells in each well of 24-well cell culture plates were transfected with a mixture of 0.5 µg pGL3-Promoter/MTA1, 2.5 ng pRL-SV40, and 100 nmol miRNA mimic by using Lipofectamine 2000 (Invitrogen) according to the instructions. Cells were lysed at 48 h after transfection, and then, the luciferase activity of MTA1 3′-UTR reporter was measured through dual-luciferase reporter gene assay.

Isolation of total RNA and quantitative reverse transcription polymerase chain reaction

Total RNA was extracted from cells using TRIzol (Invitrogen), and then, both miRNA and mRNA were reversely transcribed to cDNA. The stem-loop primer for miR-30c was 5′-GTCGTATCCAGTGCAGGGTCCGAGTATTCGCACTGGATACGACGCTGA-3′. U6 small nuclear RNA was used for normalization. PCR reactions were performed with the following primers: for miR-30c, forward 5′-GCCGCTGTAAACATCCTACACT-3′ and reverse 5′-GTGCAGGGTCCGAGGT-3′ and for U6, forward 5′-CTCGCTTCGGCAGCACA-3′ and reverse 5′-AACGCTTCACGAATTTGCGT-3′. Relative expression level of MTA1 mRNA was examined by SYBR Green real-time PCR and normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The primers were as follows: for MTA1, forward 5′-AGCTACGAGCAGCACAACGGGGT-3′ and reverse 5′-CACGCTTGGTTTCCGAGGAT-3′ and for GAPDH, forward 5′-CGTGGGCCGCCCTAGGCACCA-3′ and reverse 5′-TTGGCTTAGGGTTCAGGGGGG-3′. Primers were synthesized by Genscript (Nanjing, China). PCR was performed by using the ABI 7500 Fast Real-Time PCR system (ABI, Foster City, CA, USA).

Western blot

Total cellular protein was prepared and quantified with a bicinchoninic acid (BCA) protein assay (Beyotime, Nantong, China). Protein was fractionated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membrane. The PVDF membrane was blocked in 5% dry milk at room temperature for 1 h and immunostained with antibodies of anti-MTA1 (1:2000, ab50263; Abcam, Cambridge, UK) and anti-β-actin (1:5000, ab8226; Abcam) at 4°C overnight. After washing, the PVDF membrane was incubated with horseradish peroxidase (HRP)-conjugated anti-mouse IgG (1:2000, #7076; Cell Signaling Technology, Danvers, MA, USA) at room temperature for 1 h. All results were visualized through a chemiluminescent detection system (Thermo Fisher Scientific, Waltham, MA, USA) and then exposed with regular X-ray film. The integrated density of the band was analyzed by using the software of Quantity One (Bio-Rad, Hercules, CA, USA).

Cell survival assay

Cells were seeded into 96-well plates at 2000 cells/well. After different treatment, 500 µg/mL of 3-(4,5)-dimethylthiahiazo(-z-y1)-3,5-di-phenytetrazoliumromide (MTT; Sigma-Aldrich, St. Louis, MO, USA) was added into each well at 4 h before detection. 200 µL of dimethyl sulfoxide (DMSO) was added to each well to dissolve the precipitate at 10 min before detection. Finally, optical density (OD) value was measured at the wavelength of 490 nm. Cell survival rate was calculated with the formula: OD value of treated group/OD value of non-treated group × 100%.

Statistical methods

All statistical analyses were carried out by using SPSS 13.0 software. All data are expressed as mean ± standard deviation (SD). The statistical significance of the groups was defined as p < 0.05 and evaluated by one-way analysis of variance (ANOVA) with simultaneous multiple comparisons between groups by the Bonferroni method.

Results

Curcumin increases the sensitivity of Paclitaxel-resistant NSCLC cells to Paclitaxel

Paclitaxel-resistant A549 cells were cultured with Paclitaxel and Curcumin alone or together to examine whether Curcumin can increase the cytotoxicity of Paclitaxel to Paclitaxel-resistant A549 cells. The result showed that Paclitaxel had no significant cytotoxicity to Paclitaxel-resistant A549 cells (Figure 1(a) and (d)), but Curcumin had slight cytotoxicity to Paclitaxel-resistant A549 cells in a dose-dependent manner (Figure 1(b) and (e)). More importantly, the combinational use of Paclitaxel and Curcumin exhibited much stronger cytotoxicity to Paclitaxel-resistant A549 cells compared with Paclitaxel or Curcumin treatment alone (Figure 1(c) and (f)), indicating that Curcumin is able to increase the sensitivity of Paclitaxel-resistant NSCLC cells to Paclitaxel.
Figure 1. Curcumin increases the sensitivity of Paclitaxel-resistant A549 cells to Paclitaxel. (a and b) Paclitaxel-resistant A549 cells were cultured with (a) Paclitaxel and (b) Curcumin at different dose, respectively, and then MTT was used to detect the cell survival at 48 h after treatment (**p < 0.01 vs 0 µM group). (c) Paclitaxel-resistant A549 cells were cultured with 30 µM Paclitaxel or 30 µM Curcumin alone or the combination of 30 µM Paclitaxel and 30 µM Curcumin. MTT was used to detect the cell survival at 48 h after treatment (**p < 0.01 vs control group, ##p < 0.01 vs Paclitaxel group and Curcumin group). The data are from one experiment, representative of three independent experiments. Results were represented as means ± SD (n = 4 for each group). (d–f) The microscopic photographs of cells in (a–c) were shown.

Curcumin reduces the expression of MTA1 in Paclitaxel-resistant NSCLC cells

Given that MTA1 upregulation is closely related to NSCLC cell proliferation,24,25 to explore the potential mechanism by which Curcumin increases the sensitivity of Paclitaxel-resistant NSCLC cells to Paclitaxel, and the expression of MTA1 was further detected in Paclitaxel-resistant A549 cells after Curcumin treatment. The result showed that Curcumin obviously reduced the expression of MTA1 in Paclitaxel-resistant A549 cells at both mRNA and protein levels in a dose-dependent manner (Figure 2), suggesting MTA1 might be a downstream target of Curcumin in Paclitaxel-resistant NSCLC cells.
Figure 2. Curcumin reduces the expression of MTA1 in Paclitaxel-resistant A549 cells. Paclitaxel-resistant NSCLC cells were cultured with Curcumin at different dose for 48 h, and then, the mRNA and protein expression of MTA1 was detected by (a) real-time PCR and (b) Western blot, respectively (**p < 0.01 vs 0 µM group). The data are from one experiment, representative of three independent experiments. Results were represented as means ± SD (n = 4 for each group).

MTA1 reduction is involved in Curcumin-increased sensitivity of Paclitaxel-resistant NSCLC cells to Paclitaxel

To check whether the downregulation of MTA1 contributes the Curcumin-increased sensitivity of Paclitaxel-resistant NSCLC cells to Paclitaxel, siMTA1 was used to silence MTA1 gene, and then, the effect of Paclitaxel alone on Paclitaxel-resistant A549 cells was assayed. The result showed that knockdown of MTA1 gene could enhance the sensitivity of Paclitaxel-resistant A549 cells to Paclitaxel (Figure 3(a) and (b)). However, overexpression of MTA1 could markedly reduce Curcumin-enhanced sensitivity of Paclitaxel-resistant A549 cells to Paclitaxel (Figure 3(c) and (d)). These data indicate that MTA1 downregulation is involved in Curcumin-enhanced sensitivity of Paclitaxel-resistant NSCLC cells to Paclitaxel.
Figure 3. Downregulation of MTA1 is involved in Curcumin increased the cytotoxicity of Paclitaxel to Paclitaxel-resistant A549 cells. (a) siMTA1 and siCTR were transfected into the Paclitaxel-resistant A549 cells for 48 h, and the protein level of MTA1 was detected by Western blot (**p < 0.01 vs siCTR group). (b) siMTA1 and siCTR were transfected into the Paclitaxel-resistant A549 cells for 24 h, and then, the cells were treated with 30 µM Paclitaxel for 48 h. Subsequently, MTT was used to detect the cell survival. (**p < 0.01 vs siCTR + Paclitaxel group). (c and d) pcDNA3.1-MTA1 and pcDNA3.1 were transfected into the Paclitaxel-resistant A549 cells for 48 h, and then, the cells were treated with 30 µM Paclitaxel for 48 h. Western blot was used to detect the protein level of (c) MTA1, and MTT was used to detect the (d) cell survival (**p < 0.01 vs pcDNA3.1 + Paclitaxel + Curcumin group). The data are from one experiment, representative of three independent experiments. Results were represented as means ± SD (n = 4 for each group). (e) siMTA1 and siCTR were transfected into the Paclitaxel-resistant A549 cells for 24 h, the cells were then treated with 30 μM Paclitaxel and/or 30 μM Curcumin for 48 h. MTT assay was performed to determine the cell survival (**p < 0.01 vs siCTR + Paclitaxel group).

Curcumin reduces the expression of MTA1 gene through upregulation of miR-30c-5p in Paclitaxel-resistant NSCLC cells

To explore the potential mechanism by which Curcumin reduces the expression of MTA1 gene, the microRNA targeted at human MTA1 3′-UTR was predicted with TargetScanHuman (http://www.targetscan.org/vert_70/). We got five potential miRNAs targeted at human MTA1 3′TR, including miR-30a-5p, miR-30b-5p, miR-30c-5p, miR-30d-5p, and miR-30e-5p. Subsequent study demonstrated that Curcumin could upregulate the level of miR-30c-5p in NSCLC cells, but had no significant effect on the levels of miR-30a-5p, miR-30b-5p, miR-30d-5p, and miR-30e-5p (Figure 4(a)). Furthermore, miR-30c-5p mimic could obviously reduce the expression of MTA1 (Figure 4(b)).
Figure 4. Curcumin reduces the expression of MTA1 gene through upregulation of miR-30c-5p in Paclitaxel-resistant A549 cells. (a) The expression of mircoRNAs was detected in Paclitaxel-resistant A549 cells at 24 and 48 h after treatment (**p < 0.01 vs 0 h group). (b) miR-30c-5p mimic, control mimic, and mutant miR-30c-5p mimic were transfected into the Paclitaxel-resistant A549 cells for 48 h, and then, the expression of MTA1 mRNA was detected by real-time PCR (**p < 0.01 vs control mimic group). (c) pGL3-Promoter/WT-MTA1 and miRNA mimic were co-transfected in HEK293T cells, and then, the luciferase activity was assayed at 48 h after transfection (**p < 0.01 vs control mimic group). (d) pGL3-promoter/mutant-MTA1 and miRNA mimic were co-transfected in HEK293T cells, and then, the luciferase activity was assayed at 48 h after transfection. (e) miR-30c-5p mimic and control mimic were transfected into the Paclitaxel-resistant A549 cells, and then, MTT was used to detect the cell survival at 48 h after transfection (p < 0.01 vs control mimic + Paclitaxel group). (f) miR-30c-5p inhibitor was transfected into the Paclitaxel-resistant NSCLC cells for 24 h, and then, the cells were cultured with the combination of 30 µM Paclitaxel and 30 µM Curcumin for 48 h (**p < 0.01 vs control LAN + Paclitaxel + Curcumin group). MTT was used to detect the cell survival. The data are from one experiment, representative of three independent experiments. Results were represented as means ± SD (n = 4 for each group).
In order to confirm the regulatory effect miR-30c-5p on MTA1 gene, the luciferase reporter plasmids of WT and mutant 3′-UTR of MTA1 mRNA were used. Transfection of miR-30c-5p mimic led to a significant suppression of luciferase activity of pGL3-Promoter/WT MTA1 reporter, but transfection of mutant miR-30c-5p mimic had no significant effect (Figure 4(c)). As for pGL3-Promoter/mutant MTA1 reporter, transfection of miR-30c-5p mimic had no significant effect on its luciferase activity (Figure 4(d)). These data indicate that miR-30c-5p does degrade MTA1 mRNA through targeting at 3′-UTR of MTA1 mRNA.
Further functional study showed that miR-30c-5p mimic could increase the sensitivity of Paclitaxel-resistant A549 cells to Paclitaxel (Figure 4(e)), while miR-30c-5p inhibitor could reduce Curcumin-enhanced sensitivity of Paclitaxel-resistant A549 cells to Paclitaxel (Figure 4(f)). Subsequent experiment was done to study the effect of Curcumin-microRNA-30c-MTA1 on the sensitivity of Paclitaxel-resistant 95D NSCLC cells to Paclitaxel, and similar results were obtained (Figure 5). Taken together, these data indicate that Curcumin increases the sensitivity of Paclitaxel-resistant NSCLC cells to Paclitaxel through microRNA-30c-mediated MTA1 reduction.
Figure 5. Curcumin increases the sensitivity of Paclitaxel-resistant H460 cells to Paclitaxel through microRNA-30c-mediated MTA1 reduction. (a) The expression of MTA1 was detected by western blot in Paclitaxel-resistant H460 cells treated with Paclitaxel or Curcumin or together (**p < 0.01 vs control group). (b) MTT was used to determine the cell survival of Paclitaxel-resistant H460 cells treated with Paclitaxel or Curcumin or together (**p < 0.01 vs control group; ##p < 0.01 vs Curcumin group). (c) pcDNA3.1/MTA1 or pcDNA3.1 and LAN-anti-miR-30c-5p or control LAN were transfected into the Paclitaxel-resistant H460 cells for 24 h, and then, the cells were cultured with the combination of 30 µM Paclitaxel and 30 µM Curcumin for 48 h. Finally, MTT assay was done to detect the cell survival (**p < 0.01 vs pcDNA3.1 + control LAN + Paclitaxel + Curcumin group). The data are from one experiment, representative of three independent experiments. Results were represented as means ± SD (n = 4 for each group).

Discussion

The resistance of NSCLC cells to Paclitaxel is a major problem in clinic during Paclitaxel-based combinational chemotherapies. Notably, Curcumin has been reported to suppress the proliferation and invasion of NSCLC cells.30,31 Our present studies revealed that Curcumin treatment alone had only slight cytotoxicity to Paclitaxel-resistant NSCLC cells; however, the combinational use of Curcumin and Paclitaxel had obvious cytotoxicity to NSCLC cells, indicating that Curcumin treatment does increase the sensitivity of Paclitaxel-resistant NSCLC cells to Paclitaxel. This finding might provide an insight into the combinational use of Curcumin and Paclitaxel for treating Paclitaxel-resistant NSCLC in clinic.
Further mechanical studies revealed that Curcumin reduced the expression of MTA1 in Paclitaxel-resistant NSCLC cells. MTA1 gene knockdown could imitate the effect of Curcumin on Paclitaxel-resistant NSCLC cells. However, overexpression of MTA1 reduced the effect of Curcumin on Paclitaxel-resistant NSCLC cells. Collectively, these data indicate that the downregulation of MTA1 is involved in Curcumin-enhanced sensitivity of Paclitaxel-resistant NSCLC cells to Paclitaxel. Further studies need to be performed to find the potent mechanism by which Curcumin induces the downregulation of MTA expression.
As post-transcriptional regulation molecules, microRNAs have been identified as an abundant class of small non-coding RNAs that play important roles in various biological processes through negative regulation of target genes.32–36 Reportedly, Curcumin is able to upregulate the levels of microRNAs such as miR-192-5p, miR-365, and miR-21.37–39 Therefore, the potent upstream regulation of MTA1 by microRNAs was subsequently explored in the current studies. As a result, five potential miRNAs including miR-30a-5p, miR-30b-5p, miR-30c-5p, miR-30d-5p, and miR-30e-5p were predicted to target at human MTA1 3′-UTR through TargetScanHuman. Further study demonstrated that Curcumin could induce the upregulation of miR-30c-5p rather than other four microRNAs in NSCLC cells. More importantly, miR-30c-5p mimic could markedly reduce the expression of MTA1 and increases the sensitivity of Paclitaxel-resistant NSCLC cells to Paclitaxel, while miR-30c-5p inhibitor could decrease Curcumin-enhanced sensitivity of Paclitaxel-resistant NSCLC cells to Paclitaxel. Luciferase assay demonstrated that Curcumin-upregulated miR-30c-5p targeted at 3′-UTR of MTA1 mRNA directly and degraded MTA1 mRNA. Taken together, these data indicate that Curcumin reduces the expression of MTA1 gene through upregulation of miR-30c-5p in Paclitaxel-resistant NSCLC cells. Since Curcumin has been reported to regulate signaling molecules and transcriptional factors,15–17 further studies can be done to explore which signaling molecule and/or transcriptional factor is required for Curcumin-increased miR-30c-5p expression in Paclitaxel-resistant NSCLC cells.
In summary, the effect of Curcumin on the Paclitaxel-resistant NSCLC cells was investigated, and study revealed that Curcumin treatment could markedly increase the sensitivity of Paclitaxel-resistant NSCLC cells to Paclitaxel. Mechanically, Curcumin reduced the expression of MTA1 gene through upregulation of miR-30c in Paclitaxel-resistant NSCLC cells. Furthermore, MTA1 reduction was able to sensitize Paclitaxel-resistant NSCLC cells and enhance the effect of Paclitaxel to the cells. Our studies indicate that Curcumin might be a potential adjuvant for NSCLC patients during Paclitaxel treatment.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

This work was supported by a Grant from Department of Public Health of Jiangsu Province (YG201403), Science and Technology Developmental Grant from Suzhou City of Jiangsu Province (SYSD2013162), Social Developmental Grant from Kunshan City of Jiangsu Province (KSZ1309), and Suzhou city diagnosis and treatment special project for clinical key diseases (LCZX201518).

References

1. Zhang H, Gao L, Zhang B, et al. Prognostic value of platelet to lymphocyte ratio in non-small cell lung cancer: a systematic review and meta-analysis. Sci Rep 2016; 6: 22618.
Crossref
PubMed
Google Scholar
2. Jin F, Zhu H, Shi F, et al. A retrospective analysis of safety and efficacy of weekly nab-Paclitaxel as second-line chemotherapy in elderly patients with advanced squamous non-small-cell lung carcinoma. Clin Interv Aging 2016; 11: 167–173.
PubMed
Google Scholar
3. Gao G, Chu H, Zhao L, et al. A meta-analysis of Paclitaxel-based chemotherapies administered once every week compared with once every 3 weeks first-line treatment of advanced non-small-cell lung cancer. Lung Cancer 2012; 76: 380–386.
Crossref
PubMed
Google Scholar
4. Wang L, Li H, Ren Y, et al. Targeting HDAC with a novel inhibitor effectively reverses Paclitaxel resistance in non-small cell lung cancer via multiple mechanisms. Cell Death Dis 2016; 7: e2063.
Crossref
PubMed
Google Scholar
5. Park SH, Seong MA, Lee HY. p38 MAPK-induced MDM2 degradation confers Paclitaxel resistance through p53-mediated regulation of EGFR in human lung cancer cells. Oncotarget 2016; 7: 8184–8199.
Crossref
PubMed
Google Scholar
6. Gao S, Zhou J, Liu N, et al. Curcumin induces M2 macrophage polarization by secretion IL-4 and/or IL-13. J Mol Cell Cardiol 2015; 85: 131–139.
Crossref
PubMed
Google Scholar
7. Liu BL, Chen YP, Cheng H, et al. The protective effects of Curcumin on obesity-related glomerulopathy are associated with inhibition of Wnt/β-catenin signaling activation in podocytes. Evid Based Complement Alternat Med 2015; 2015: 827472.
Crossref
PubMed
Google Scholar
8. Lian N, Jiang Y, Zhang F, et al. Curcumin regulates cell fate and metabolism by inhibiting hedgehog signaling in hepatic stellate cells. Lab Invest 2015; 95: 790–803.
Crossref
PubMed
Google Scholar
9. Wu JX, Zhang LY, Chen YL, et al. Curcumin pretreatment and post-treatment both improve the antioxidative ability of neurons with oxygen-glucose deprivation. Neural Regen Res 2015; 10: 481–489.
Crossref
PubMed
Google Scholar
10. Xu F, Lin SH, Yang YZ, et al. The effect of Curcumin on sepsis-induced acute lung injury in a rat model through the inhibition of the TGF-β1/SMAD3 pathway. Int Immunopharmacol 2013; 16: 1–6.
Crossref
PubMed
Google Scholar
11. Wen X, Cheng X, Hu D, et al. Combination of Curcumin with an anti-transferrin receptor antibody suppressed the growth of malignant gliomas in vitro. Turk Neurosurg 2016; 26: 209–214.
PubMed
Google Scholar
12. Mosieniak G, Sliwinska MA, Przybylska D, et al. Curcumin-treated cancer cells show mitotic disturbances leading to growth arrest and induction of senescence phenotype. Int J Biochem Cell Biol 2016; 74: 33–43.
Crossref
PubMed
Google Scholar
13. Fan Z, Duan X, Cai H, et al. Curcumin inhibits the invasion of lung cancer cells by modulating the PKCα/Nox-2/ROS/ATF-2/MMP-9 signaling pathway. Oncol Rep 2015; 34: 691–698.
Crossref
PubMed
Google Scholar
14. Guo H, Xu Y, Fu Q. Curcumin inhibits growth of prostate carcinoma via miR-208-mediated CDKN1A activation. Tumour Biol 2015; 36: 8511–8517.
Crossref
PubMed
Google Scholar
15. Mishra A, Kumar R, Tyagi A, et al. Curcumin modulates cellular AP-1, NF-kB, and HPV16 E6 proteins in oral cancer. Ecancermedicalscience 2015; 9: 525.
Crossref
PubMed
Google Scholar
16. Pandey A, Vishnoi K, Mahata S, et al. Berberine and Curcumin target survivin and STAT3 in gastric cancer cells and synergize actions of standard chemotherapeutic 5-fluorouracil. Nutr Cancer 2015; 67: 1293–1304.
Crossref
PubMed
Google Scholar
17. Zhao Z, Li C, Xi H, et al. Curcumin induces apoptosis in pancreatic cancer cells through the induction of forkhead box O1 and inhibition of the PI3K/Akt pathway. Mol Med Rep 2015; 12: 5415–5422.
Crossref
PubMed
Google Scholar
18. Chen J, Xu T, Chen C. The critical roles of miR-21 in anti-cancer effects of Curcumin. Ann Transl Med 2015; 3: 330.
PubMed
Google Scholar
19. Xu C, Hua F, Chen Y, et al. MTA1 promotes metastasis of MPM via suppression of E-cadherin. J Exp Clin Cancer Res 2015; 34: 151.
Crossref
PubMed
Google Scholar
20. Li J, Ye L, Sun PH, et al. MTA1 is up-regulated in colorectal cancer and is inversely correlated with lymphatic metastasis. Cancer Genomics Proteomics 2015; 12: 339–345.
PubMed
Google Scholar
21. Deng L, Yang H, Tang J, et al. Inhibition of MTA1 by ERα contributes to protection hepatocellular carcinoma from tumor proliferation and metastasis. J Exp Clin Cancer Res 2015; 34: 128.
Crossref
PubMed
Google Scholar
22. Yao Y, Feng S, Xiao M, et al. MTA1 promotes proliferation and invasion in human gastric cancer cells. Onco Targets Ther 2015; 8: 1785–1794.
Crossref
PubMed
Google Scholar
23. Sheridan CM, Grogan TR, Nguyen HG, et al. YB-1 and MTA1 protein levels and not DNA or mRNA alterations predict for prostate cancer recurrence. Oncotarget 2015; 6: 7470–7480.
Crossref
PubMed
Google Scholar
24. Li Y, Chao Y, Fang Y, et al. MTA1 promotes the invasion and migration of non-small cell lung cancer cells by downregulating miR-125b. J Exp Clin Cancer Res 2013; 32: 33.
Crossref
PubMed
Google Scholar
25. Li S, Tian H, Yue W, et al. Down-regulation of MTA1 protein leads to the inhibition of migration, invasion, and angiogenesis of non-small-cell lung cancer cell line. Acta Bioch Bioph Sin 2013; 45: 115–122.
Crossref
PubMed
Google Scholar
26. Kong X, Xu X, Yan Y, et al. Estrogen regulates the tumour suppressor MmiRNA-30c and its target gene, MTA-1, in endometrial cancer. PLoS ONE 2014; 9: e90810.
Crossref
PubMed
Google Scholar
27. Avtanski DB, Nagalingam A, Kuppusamy P, et al. Honokiol abrogates leptin-induced tumor progression by inhibiting Wnt1-MTA1-β-catenin signaling axis in a microRNA-34a dependent manner. Oncotarget 2015; 6: 16396–16410.
Crossref
PubMed
Google Scholar
28. Han F, Zhang L, Zhou Y, et al. Caveolin-1 regulates cell apoptosis and invasion ability in Paclitaxel-induced multidrug-resistant a549 lung cancer cells. Int J Clin Exp Pathol 2015; 8: 8937–8947.
PubMed
Google Scholar
29. Chu JJ, Chiang CD, Rao CS, et al. Establishment and characterization of a Paclitaxel-resistant human non-small cell lung cancer cell line. Anticancer Res 2000; 20: 2449–2456.
PubMed
Google Scholar
30. Lu Y, Wei C, Xi Z. Curcumin suppresses proliferation and invasion in non-small cell lung cancer by modulation of MTA1-mediated Wnt/β-catenin pathway. In Vitro Cell Dev Biol 2014; 50: 840–850.
Crossref
Google Scholar
31. Tsai JR, Liu PL, Chen YH, et al. Curcumin inhibits non-small cell lung cancer cells metastasis through the adiponectin/NF-κb/MMPs signaling pathway. PLoS ONE 2015; 10: e0144462.
Crossref
Google Scholar
32. Chu SJ, Wang G, Zhang PF, et al. MicroRNA-203 suppresses gastric cancer growth by targeting PIBF1/Akt signaling. J Exp Clin Cancer Res 2016; 35: 47.
Crossref
PubMed
Google Scholar
33. Gong XC, Xu YQ, Jiang Y, et al. Onco-microRNA mir-130b promoting cell growth in children APL by targeting PTEN. Asian Pac J Trop Med 2016; 9: 265–268.
Crossref
PubMed
Google Scholar
34. Murai K, Sun G, Ye P, et al. The TLX-miR-219 cascade regulates neural stem cell proliferation in neurodevelopment and schizophrenia iPSC model. Nat Commun 2016; 7: 10965.
Crossref
PubMed
Google Scholar
35. Ichii O, Otsuka-Kanazawa S, Horino T, et al. Decreased miR-26a expression correlates with the progression of podocyte injury in autoimmune glomerulonephritis. PLoS ONE 2014; 9: e110383.
Crossref
PubMed
Google Scholar
36. Wu K, Zhu C, Yao Y, et al. MicroRNA-155-enhanced autophagy in human gastric epithelial cell in response to Helicobacter pylori. Saudi J Gastroenterol 2016; 22: 30–36.
Crossref
PubMed
Google Scholar
37. Jin H, Qiao F, Wang Y, et al. Curcumin inhibits cell proliferation and induces apoptosis of human non-small cell lung cancer cells through the upregulation of miR-192-5p and suppression of PI3K/Akt signaling pathway. Oncol Rep 2015; 34: 2782–2789.
Crossref
PubMed
Google Scholar
38. Li G, Bu J, Zhu Y, et al. Curcumin improves bone microarchitecture in glucocorticoid-induced secondary osteoporosis mice through the activation of microRNA-365 via regulating MMP-9. Int J Clin Exp Pathol 2015; 8: 15684–15695.
PubMed
Google Scholar
39. Yeh WL, Lin HY, Huang CY, et al. Migration-prone glioma cells show curcumin resistance associated with enhanced expression of miR-21 and invasion/anti-apoptosis-related proteins. Oncotarget 2015; 6: 37770–37781.
Crossref
PubMed
Google Scholar

Cite article

Cite article

Cite article

OR

Download to reference manager

If you have citation software installed, you can download article citation data to the citation manager of your choice

Share options

Share

Share this article

Share with email
EMAIL ARTICLE LINK
Share on social media

Share access to this article

Sharing links are not relevant where the article is open access and not available if you do not have a subscription.

For more information view the Sage Journals article sharing page.

Information, rights and permissions

Information

Published In

Volume 39, Issue 4
Article first published online: April 26, 2017
Issue published: April 2017

Keywords

  1. Non-small-cell lung cancer
  2. Paclitaxel resistance
  3. Curcumin
  4. metastasis-associated gene 1
  5. microRNA-30c

Rights and permissions

© The Author(s) 2017.
Creative Commons License (CC BY-NC 4.0)
This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (http://www.creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access page(https://us.sagepub.com/en-us/nam/open-access-at-sage).
Request permissions for this article.
PubMed: 28443468

Authors

Affiliations

Yimin Lu
Department of Respiratory, The First People’s Hospital of Kunshan Affiliated to Jiangsu University, Suzhou, China
[email protected]
View all articles by this author
Jun Wang
Department of Respiratory, Suzhou Kowloon Hospital Affiliated with Shanghai Jiao Tong University School of Medicine, Suzhou, China
View all articles by this author
Lei Liu
Department of Respiratory, The First People’s Hospital of Kunshan Affiliated to Jiangsu University, Suzhou, China
View all articles by this author
Lequn Yu
Department of Respiratory, The First People’s Hospital of Kunshan Affiliated to Jiangsu University, Suzhou, China
View all articles by this author
Nian Zhao
Department of Respiratory, The First People’s Hospital of Kunshan Affiliated to Jiangsu University, Suzhou, China
View all articles by this author
Xingju Zhou
Department of Respiratory, The First People’s Hospital of Kunshan Affiliated to Jiangsu University, Suzhou, China
View all articles by this author
Xudong Lu
Department of Respiratory, The First People’s Hospital of Kunshan Affiliated to Jiangsu University, Suzhou, China
View all articles by this author

Notes

Yimin Lu, Department of Respiratory, The First People’s Hospital of Kunshan Affiliated to Jiangsu University, 91 Qianjin West Road, Suzhou, Jiangsu 215300, China. Email: [email protected]

Metrics and citations

Metrics

Journals metrics

This article was published in Tumor Biology.

VIEW ALL JOURNAL METRICS

Article usage*

Total views and downloads: 1531

*Article usage tracking started in December 2016

Articles citing this one

Receive email alerts when this article is cited

Web of Science: 27 view articles Opens in new tab

Crossref: 30

  1. Role of microRNAs in regulation of doxorubicin and paclitaxel response...
    Go to citation Crossref Google Scholar
  2. Baseline extracellular vesicle miRNA-30c and autophagic CTCs predict c...
    Go to citation Crossref Google Scholar
  3. Construction of curcumin-loaded micelles and evaluation of the anti-tu...
    Go to citation Crossref Google Scholar
  4. Involvement of microRNA modifications in anticancer effects of major p...
    Go to citation Crossref Google Scholar
  5. Current insights into epigenetics, noncoding RNA interactome and clini...
    Go to citation Crossref Google Scholar
  6. Future Perspectives of Phytochemicals in Cancer Therapy
    Go to citation Crossref Google Scholar
  7. Nano-drug co-delivery system of natural active ingredients and chemoth...
    Go to citation Crossref Google Scholar
  8. The role of polyphenols in overcoming cancer drug resistance: a compre...
    Go to citation Crossref Google Scholar
  9. Contribution of Non-Coding RNAs to Anticancer Effects of Dietary Polyp...
    Go to citation Crossref Google Scholar
  10. A systematic review of phytochemicals from Chinese herbal medicines fo...
    Go to citation Crossref Google Scholar
  11. Curcumin and Its Analogs in Non-Small Cell Lung Cancer Treatment: Chal...
    Go to citation Crossref Google Scholar
  12. Polyphenols as Lung Cancer Chemopreventive Agents by Targeting microRN...
    Go to citation Crossref Google Scholar
  13. Curcumin Increased the Sensitivity of Non-Small-Cell Lung Cancer to Ci...
    Go to citation Crossref Google Scholar
  14. Metastasis-associated protein 1: A potential driver and regulator of t...
    Go to citation Crossref Google Scholar
  15. Dietary regulation of miRNA in precision medicine of lung cancer
    Go to citation Crossref Google Scholar
  16. Molecular mechanisms underlying curcumin-mediated microRNA regulation ...
    Go to citation Crossref Google Scholar
  17. Targeting microRNAs by curcumin: implication for cancer therapy
    Go to citation Crossref Google Scholar
  18. Perspectives and controversies regarding the use of natural products f...
    Go to citation Crossref Google Scholar
  19. Role of non-coding RNAs in modulating the response of cancer cells to ...
    Go to citation Crossref Google Scholar
  20. Versatile role of curcumin and its derivatives in lung cancer therapy
    Go to citation Crossref Google Scholar
  21. Therapeutic potentials of curcumin in the treatment of non‐small‐cell ...
    Go to citation Crossref Google Scholar
  22. MicroRNA-34c-3p target inhibiting NOTCH1 suppresses chemosensitivity a...
    Go to citation Crossref Google ScholarPub Med
  23. The Cytoprotective and Anti-cancer Potential of Bisbenzylisoquinoline ...
    Go to citation Crossref Google Scholar
  24. Bioactive Ingredients in Chinese Herbal Medicines That Target Non-codi...
    Go to citation Crossref Google Scholar
  25. The Preparation, Determination of a Flexible Complex Liposome Co-Loade...
    Go to citation Crossref Google Scholar
  26. Melatonin Inhibits the Progression of Hepatocellular Carcinoma through...
    Go to citation Crossref Google Scholar
  27. Differential effects of natural Curcumin and chemically modified curcu...
    Go to citation Crossref Google Scholar
  28. Latest in Vitro and in Vivo Assay, Clinical Trials and Patents in Canc...
    Go to citation Crossref Google Scholar
  29. Curcumin increases breast cancer cell sensitivity to cisplatin by decr...
    Go to citation Crossref Google Scholar
  30. Diet and cancer prevention: Dietary compounds, dietary MicroRNAs, and ...
    Go to citation Crossref Google Scholar

Figures and tables

Figures & Media

Tables

View Options

View options

PDF/ePub

View PDF/ePub

Get access

Access options

If you have access to journal content via a personal subscription, university, library, employer or society, select from the options below:

Alternatively, view purchase options below:

Purchase 24 hour online access to view and download content.

Subscribe to this journal

Access journal content via a DeepDyve subscription or find out more about this option.

Start 2 week free trial
Need help?

Also from Sage