Emodin Sensitizes Hepatocellular Carcinoma Cells to the Anti-Cancer Effect of Sorafenib through Suppression of Cholesterol Metabolism
Abstract
:1. Introduction
2. Results
2.1. Synergistic Anti-Cancer Effect of Combination of Emodin and Sorafenib in HCC Cells
2.2. Emodin Did Not Sensitize HCC to the Anti-Cancer Activity of Doxorubicin or 5-Fluorouracil
2.3. Combination Therapy of Emodin and Sorafenib Caused Cell Cycle Arrest and Apoptosis in HCC Cells
2.4. Emodin Suppressed Cholesterogenic Gene Expression and Intracellular Cholesterol Levels through the Attenuation of SREBP-2 in HCC Cells
2.5. Combination of Emodin and Sorafenib Synergistically Suppresses Cholesterogenic Genes Expression and Causes Cell Death in HCC Cells
2.6. Emodin Suppressed Oncogenic AKT Signaling Caused by Intracellular Cholesterol Depletion in HCC Cells
2.7. Cholesterol-Lowering Effects of Emodin Caused STAT3 Phosphorylation and Associated Expression of Cell Cycle Regulating Genes in HCC Cells
2.8. Combination Therapy of Emodin and Sorafenib Suppressed Tumor Growth In Vivo
3. Discussion
4. Materials and Methods
4.1. Reagents and Antibodies
4.2. Cell Culture and Cell Viability Assay
4.3. Western Blotting
4.4. Quantitative Real-Time PCR
4.5. Tumor Xenograft Assay and Immunohistochemistry
4.6. Cell Cycle Analysis
4.7. Ki67 Cell Proliferation Assay
4.8. Apoptosis Assays
4.9. Measurement of Intracellular Cholesterol
4.10. Luciferase Assay
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
HCC | Hepatocellular carcinoma |
SREBP-2 | Sterol regulatory element-binding protein-2 |
AKT | Protein kinase B |
STAT3 | Signal transducer and activator of transcription 3 |
MAPK | Mitogen-activated protein kinase |
PI3K | Phosphoinositide 3-kinase |
HMGCS1 | 3-hydroxy-3-methylglutaryl-CoA synthase 1 |
HMGCR | 3-hydroxy-3-methylglutaryl-coenzyme A reductase |
FDPS | Farnesyl diphosphate synthase |
MVD | Mevalonate diphosphate decarboxylase |
DHCR7 | 7-dehydrocholesterol reductase |
DHCR24 | 24-dehydrocholesterol reductase |
5-FU | 5-fluorouracil |
BCL-2 | B-cell lymphoma 2 |
VEGF-A | Vascular endothelial growth factor A |
bFGF | Basic fibroblast growth factor |
HGF | Hepatocyte growth factor |
MMP-3 | Matrix metalloproteinase-3 |
MMP-9 | Matrix metalloproteinase-9 |
References
- Le Grazie, M.; Biagini, M.R.; Tarocchi, M.; Polvani, S.; Galli, A. Chemotherapy for hepatocellular carcinoma: The present and the future. World J. Hepatol. 2017, 9, 907–920. [Google Scholar] [CrossRef] [PubMed]
- Greten, T.F.; Korangy, F.; Manns, M.P.; Malek, N.P. Molecular therapy for the treatment of hepatocellular carcinoma. Br. J. Cancer 2009, 100, 19–23. [Google Scholar] [CrossRef] [PubMed]
- Llovet, J.M.; Ricci, S.; Mazzaferro, V.; Hilgard, P.; Gane, E.; Blanc, J.F. Sorafenib in advanced hepatocellular carcinoma. N. Eng. J. Med. 2008, 359, 378–390. [Google Scholar] [CrossRef] [PubMed]
- Huang, Q.; Lu, G.; Shen, H.M.; Chung, M.C.; Ong, C.N. Anti-cancer properties of anthraquinones from rhubarb. Med. Res. Rev. 2007, 27, 609–630. [Google Scholar] [CrossRef] [PubMed]
- Li-Weber, M. Targeting apoptosis pathways in cancer by Chinese medicine. Cancer Lett. 2013, 332, 304–312. [Google Scholar] [CrossRef] [PubMed]
- Xing, J.Y.; Song, G.P.; Deng, J.P.; Jiang, L.Z.; Xiong, P.; Yang, B.J. Antitumor effects and mechanism of novel emodin rhamnoside derivatives against human cancer cells in vitro. PLoS ONE 2015, 10, e0144781. [Google Scholar] [CrossRef] [PubMed]
- Gu, J.; Cui, C.F.; Yang, L.; Wang, L.; Jiang, X.H. Emodin inhibits colon cancer cell invasion and migration by suppressing epithelialmesenchymal transition via the Wnt/beta-catenin pathway. Oncol. Res. 2018, 32, 30–32. [Google Scholar]
- Zhang, L.; Chang, C.J.; Bacus, S.S.; Hung, M.C. Suppressed transformation and induced differentiation of HER-2/neu-overexpressing breast cancer cells by emodin. Cancer Res. 1995, 55, 3890–3896. [Google Scholar] [PubMed]
- Lin, W.; Zhong, M.; Yin, H.; Chen, Y.; Cao, Q.; Wang, C. Emodin induces hepatocellular carcinoma cell apoptosis through MAPK and PI3K/AKT signaling pathways in vitro and in vivo. Oncol. Rep. 2016, 36, 961–967. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, W.; Chen, H.; Liu, D.L.; Li, H.; Luo, J.; Zhang, J.H. Emodin sensitizes the gemcitabine-resistant cell line Bxpc-3/Gem to gemcitabine via downregulation of NF-kappaB and its regulated targets. Int. J. Oncol. 2013, 42, 1189–1196. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Liu, P.; Mao, H. , Wanga, A.; Zhang, X. Emodin sensitizes paclitaxel-resistant human ovarian cancer cells to paclitaxel-induced apoptosis in vitro. Oncol. Rep. 2009, 21, 1605–1610. [Google Scholar] [PubMed]
- Zhang, L.; Hung, M.C. Sensitization of HER-2/neu-overexpressing non-small cell lung cancer cells to chemotherapeutic drugs by tyrosine kinase inhibitor emodin. Oncogene 1996, 12, 571–576. [Google Scholar] [PubMed]
- Zhang, L.; Lau, Y.K.; Xia, W.; Hortobagyi, G.N.; Hung, M.C. Tyrosine kinase inhibitor emodin suppresses growth of HER-2/neu-overexpressing breast cancer cells in athymic mice and sensitizes these cells to the inhibitory effect of paclitaxel. Clin. Cancer Res. 1999, 5, 343–353. [Google Scholar] [PubMed]
- Beloribi-Djefaflia, S.; Vasseur, S.; Guillaumond, F. Lipid metabolic reprogramming in cancer cells. Oncogenesis 2016, 5, e189. [Google Scholar] [CrossRef] [PubMed]
- Cruz, P.M.; Mo, H.; McConathy, W.J.; Sabnis, N.; Lacko, A.G. The role of cholesterol metabolism and cholesterol transport in carcinogenesis: A review of scientific findings, relevant to future cancer therapeutics. Frontiers Pharmacol. 2013, 4, 119. [Google Scholar] [CrossRef] [PubMed]
- DeBose-Boyd, R.A.; Ye, J. SREBPs in lipid metabolism, insulin signaling, and beyond. Trends Biochem. Sci. 2018, 43, 358–368. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Cao, Y.; Chen, C.; Zhang, X.; McNabola, A.; Wilkie, D. Sorafenib blocks the RAF/MEK/ERK pathway, inhibits tumor angiogenesis, and induces tumor cell apoptosis in hepatocellular carcinoma model PLC/PRF/5. Cancer Res. 2006, 66, 11851–11858. [Google Scholar] [CrossRef] [PubMed]
- Murray, A. Cell cycle checkpoints. Curr. Opin. Cell. Biol. 1994, 6, 872–876. [Google Scholar] [CrossRef]
- Li, J.; Ding, L.; Song, B.; Xiao, X.; Qi, M.; Yang, Q. Emodin improves lipid and glucose metabolism in high fat diet-induced obese mice through regulating SREBP pathway. Eur. J. Pharmacol. 2016, 770, 99–109. [Google Scholar] [CrossRef] [PubMed]
- Zhuang, L.; Kim, J.; Adam, R.M.; Solomon, K.R.; Freeman, M.R. Cholesterol targeting alters lipid raft composition and cell survival in prostate cancer cells and xenografts. J. Clin. Investig. 2005, 115, 959–968. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghalali, A.; Martin-Renedo, J.; Hogberg, J.; Stenius, U. Atorvastatin decreases HBx-induced phospho-Akt in hepatocytes via P2X receptors. Mol. Cancer Res. 2017, 15, 714–722. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.C.; Gowda, R.; Newswanger, R.K.; Leibich, P.; Fell, B.; Rosenberg, G. Targeting cholesterol transport in circulating melanoma cells to inhibit metastasis. Pigment Cell Melanoma Res. 2017, 30, 541–552. [Google Scholar] [CrossRef] [PubMed]
- Afshordel, S.; Kern, B.; Clasohm, J.; Konig, H.; Priester, M.; Weissenberger, J. Lovastatin and perillyl alcohol inhibit glioma cell invasion, migration, and proliferation–impact of Ras-/Rho-prenylation. Pharmacol. Res. 2015, 91, 69–77. [Google Scholar] [CrossRef] [PubMed]
- Stine, J.E.; Guo, H.; Sheng, X.; Han, X.; Schointuch, M.N.; Gilliam, T.P. The HMG-CoA reductase inhibitor, simvastatin, exhibits anti-metastatic and anti-tumorigenic effects in ovarian cancer. Oncotarget 2016, 7, 946–960. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Guo, G.; Song, J.; Cai, Z.; Yang, J.; Chen, Z. B7-H3 promotes the migration and invasion of human bladder cancer cells via the PI3K/Akt/STAT3 signaling pathway. J. Cancer 2017, 8, 816–824. [Google Scholar] [CrossRef] [PubMed]
- Carpenter, R.L.; Lo, H.W. STAT3 target genes relevant to human cancers. Cancers 2014, 6, 897–925. [Google Scholar] [CrossRef] [PubMed]
- Monisha, B.A.; Kumar, N.; Tiku, A.B. Emodin and its role in chronic diseases. Adv. Exp. Med. Biol. 2016, 928, 47–73. [Google Scholar] [PubMed]
- He, Y.; Huang, J.; Wang, P.; Shen, X.; Li, S.; Yang, L. Emodin potentiates the antiproliferative effect of interferon alpha/beta by activation of JAK/STAT pathway signaling through inhibition of the 26S proteasome. Oncotarget 2016, 7, 4664–4679. [Google Scholar] [PubMed]
- Subramaniam, A.; Shanmugam, M.K.; Ong, T.H.; Li, F.; Perumal, E.; Chen, L. Emodin inhibits growth and induces apoptosis in an orthotopic hepatocellular carcinoma model by blocking activation of STAT3. Br. J. Pharmacol. 2013, 170, 807–821. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Enriquez-Cortina, C.; Bello-Monroy, O.; Rosales-Cruz, P.; Souza, V.; Miranda, R.U.; Toledo-Perez, R. Cholesterol overload in the liver aggravates oxidative stress-mediated DNA damage and accelerates hepatocarcinogenesis. Oncotarget 2017, 8, 104136–104148. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carr, B.I.; Giannelli, G.; Guerra, V.; Giannini, E.G.; Farinati, F.; Rapaccini, G.L. Plasma cholesterol and lipoprotein levels in relation to tumor aggressiveness and survival in HCC patients. Int. J. Biol. Marker 2018, 18, 136–148. [Google Scholar] [CrossRef] [PubMed]
- Fang, Z.; Tang, Y.; Fang, J.; Zhou, Z.; Xing, Z.; Guo, Z. Simvastatin inhibits renal cancer cell growth and metastasis via AKT/mTOR, ERK and JAK2/STAT3 pathway. PLoS ONE 2013, 8, e62823. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.T.; Ho, H.J.; Lin, J.T.; Shieh, J.J.; Wu, C.Y. Simvastatin-induced cell cycle arrest through inhibition of STAT3/SKP2 axis and activation of AMPK to promote p27 and p21 accumulation in hepatocellular carcinoma cells. Cell Death Dis. 2017, 8, e2626. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ogura, S.; Yoshida, Y.; Kurahashi, T.; Egawa, M.; Furuta, K.; Kiso, S. Targeting the mevalonate pathway is a novel therapeutic approach to inhibit oncogenic FoxM1 transcription factor in human hepatocellular carcinoma. Oncotarget 2018, 9, 21022–21035. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, Y.; Luo, R.; Zheng, H.; Wang, B.; Liu, Y.; Liu, D. Synergistic anti-tumor efficacy of sorafenib and fluvastatin in hepatocellular carcinoma. Oncotarget 2017, 8, 23265–23276. [Google Scholar] [CrossRef] [PubMed]
- Chen, K.F.; Yu, H.C.; Liu, T.H.; Lee, S.S.; Chen, P.J.; Cheng, A.L. Synergistic interactions between sorafenib and bortezomib in hepatocellular carcinoma involve PP2A-dependent Akt inactivation. J. Hepatol. 2010, 52, 88–95. [Google Scholar] [CrossRef] [PubMed]
- Huynh, H.; Ngo, V.C.; Koong, H.N.; Poon, D.; Choo, S.P.; Thng, C.H. Sorafenib and rapamycin induce growth suppression in mouse models of hepatocellular carcinoma. J. Cell. Mol. Med. 2009, 13, 2673–2683. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huynh, H.; Ngo, V.C.; Koong, H.N.; Poon, D.; Choo, S.P.; Toh, H.C. AZD6244 enhances the anti-tumor activity of sorafenib in ectopic and orthotopic models of human hepatocellular carcinoma (HCC). J. Hepatol. 2010, 52, 79–87. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Kim, S.G.; Blenis, J. Rapamycin: One drug, many effects. Cell Metab 2014, 19, 373–379. [Google Scholar] [CrossRef] [PubMed]
- Schwartz, G.K.; Tap, W.D.; Qin, L.X.; Livingston, M.B.; Undevia, S.D.; Chmielowski, B. Cixutumumab and temsirolimus for patients with bone and soft-tissue sarcoma: A multicentre, open-label, phase 2 trial. Lancet 2013, 14, 371–382. [Google Scholar] [CrossRef]
- Chen, D.; Frezza, M.; Schmitt, S.; Kanwar, J.; Dou, Q.P. Bortezomib as the first proteasome inhibitor anticancer drug: Current status and future perspectives. Curr Cancer Drug Targets 2011, 11, 239–253. [Google Scholar] [CrossRef] [PubMed]
- Balagula, Y.; Barth Huston, K.; Busam, K.J.; Lacouture, M.E.; Chapman, P.B.; Myskowski, P.L. Dermatologic side effects associated with the MEK 1/2 inhibitor selumetinib (AZD6244, ARRY-142886). Inv. New Drugs 2011, 29, 1114–1121. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.S.; Weng, S.W.; Lin, M.W.; Lu, C.C.; Chiang, J.H.; Yang, J.S. Antitumor effects of emodin on LS1034 human colon cancer cells in vitro and in vivo: Roles of apoptotic cell death and LS1034 tumor xenografts model. Food Chem. Toxicol. 2012, 50, 1271–1278. [Google Scholar] [CrossRef] [PubMed]
- Cha, T.L.; Qiu, L.; Chen, C.T.; Wen, Y.; Hung, M.C. Emodin down-regulates androgen receptor and inhibits prostate cancer cell growth. Cancer Res. 2005, 65, 2287–2295. [Google Scholar] [CrossRef] [PubMed]
- Chun-Guang, W.; Jun-Qing, Y.; Bei-Zhong, L.; Dan-Ting, J.; Chong, W.; Liang, Z. Anti-tumor activity of emodin against human chronic myelocytic leukemia K562 cell lines in vitro and in vivo. Eur. J. Pharmacol 2010, 627, 33–41. [Google Scholar] [CrossRef] [PubMed]
- Oh, T.I.; Lee, Y.M.; Nam, T.J.; Ko, Y.S.; Mah, S.; Kim, J. Fascaplysin exerts anti-cancer effects through the downregulation of survivin and HIF-1alpha and inhibition of VEGFR2 and TRKA. Int. J. Mol. Sci. 2017, 18, 133–141. [Google Scholar] [CrossRef] [PubMed]
- Smith, J.R.; Osborne, T.F.; Brown, M.S.; Goldstein, J.L.; Gil, G. Multiple sterol regulatory elements in promoter for hamster 3-hydroxy-3-methylglutaryl-coenzyme A. synthase. J. Biol. Chem. 1988, 263, 18480–18487. [Google Scholar] [PubMed]
- Sun, X.; Song, Q.; Yan, L.H.; Lu, J.; Zhang, Q.; Yu, Q. Receptor Tyrosine Kinase Phosphorylation Pattern-Based Multidrug Combination Is an Effective Approach for Personalized Cancer Treatment. Mol. Cancer Ther. 2016, 15, 2508–2520. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer | Reverse Primer |
---|---|---|
HMGCS1 | TGGCAGGGAGTCTTGGTA | TCCCACTCCAAATGATGACA |
HMGCR | GATGGGAGGCCACAAAGAG | TTCGGTGGCCTCTAGTGAGA |
MVD | TTAACTGGTCCTGGTGCAGA | AACATCGCGGTCATCAAGTA |
FDPS | TCCATGATGTCATCTGCCAC | AGCCAAGGAAACAGGATG |
DHCR7 | CTTGAGATGCGGTTCTGTCA | TATTTGGCAAGAGGCTGGAG |
DHCR24 | CTGAAGACAAACCGAGAGGG | TGTTGCCAAAGGGGATAATG |
BCL-2 | CGTACAGTTCCACAAAGGCA | ATGTGTGTGGAGAGCGTCAA |
Survivin | CTTTCTCCGCAGTTTCCTCA | TTGGTGAATTTTTGAAACTGGA |
Cyclin D1 | ATGGAACACCAGCTCCTGTGCTGC | TCAGATGTCCACGTCCCGCACGT |
VEGFA | AGCTGCGCTGATAGACATCC | CTACCTCCACCATGCCAAGT |
bFGF | CCGACGGCCGAGTTGAC | TAACGGTTAGCACACACTCCTTTG |
MMP-3 | ACAAAGGATACAACAGGGACCA | GTGAGTGAGTGATAGAGTGGGT |
MMP-9 | CAGTCCACCCTTGTGCTCTT | CCCGAGTGTAACCATAGCGG |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, Y.-S.; Lee, Y.-M.; Oh, T.-I.; Shin, D.H.; Kim, G.-H.; Kan, S.-Y.; Kang, H.; Kim, J.H.; Kim, B.M.; Yim, W.J.; et al. Emodin Sensitizes Hepatocellular Carcinoma Cells to the Anti-Cancer Effect of Sorafenib through Suppression of Cholesterol Metabolism. Int. J. Mol. Sci. 2018, 19, 3127. https://doi.org/10.3390/ijms19103127
Kim Y-S, Lee Y-M, Oh T-I, Shin DH, Kim G-H, Kan S-Y, Kang H, Kim JH, Kim BM, Yim WJ, et al. Emodin Sensitizes Hepatocellular Carcinoma Cells to the Anti-Cancer Effect of Sorafenib through Suppression of Cholesterol Metabolism. International Journal of Molecular Sciences. 2018; 19(10):3127. https://doi.org/10.3390/ijms19103127
Chicago/Turabian StyleKim, Young-Seon, Yoon-Mi Lee, Taek-In Oh, Dong Hoon Shin, Geon-Hee Kim, Sang-Yeon Kan, Hyeji Kang, Ji Hyung Kim, Byeong Mo Kim, Woo Jong Yim, and et al. 2018. "Emodin Sensitizes Hepatocellular Carcinoma Cells to the Anti-Cancer Effect of Sorafenib through Suppression of Cholesterol Metabolism" International Journal of Molecular Sciences 19, no. 10: 3127. https://doi.org/10.3390/ijms19103127