DNA barcoding uncovers cryptic diversity in 50% of deep-sea Antarctic polychaetes
- This article has a Correction
Correction
- Correction to ‘DNA barcoding uncovers cryptic diversity in 50% of deep-sea Antarctic polychaetes’
- https://doi.org/10.1098/rsos.160937
-
- volume 4issue 1Royal Society Open Science
- 01 January 2017
- Review history
Abstract
The Antarctic marine environment is a diverse ecosystem currently experiencing some of the fastest rates of climatic change. The documentation and management of these changes requires accurate estimates of species diversity. Recently, there has been an increased recognition of the abundance and importance of cryptic species, i.e. those that are morphologically identical but genetically distinct. This article presents the largest genetic investigation into the prevalence of cryptic polychaete species within the deep Antarctic benthos to date. We uncover cryptic diversity in 50% of the 15 morphospecies targeted through the comparison of mitochondrial DNA sequences, as well as 10 previously overlooked morphospecies, increasing the total species richness in the sample by 233%. Our ability to describe universal rules for the detection of cryptic species within polychaetes, or normalization to expected number of species based on genetic data is prevented by taxon-specific differences in phylogenetic outputs and genetic variation between and within potential cryptic species. These data provide the foundation for biogeographic and functional analysis that will provide insight into the drivers of species diversity and its role in ecosystem function.
1. Introduction
Antarctica is a fragile environment currently undergoing some of the fastest rates of climatic change on the planet [1,2]. These changes are predicted to have a significant impact on its marine communities if species are unable to adapt to their new conditions [3,4]. In order to detect, document and manage the impact of environmental change our knowledge of species diversity needs to be improved. For these reasons there has been an increased effort to accurately document and assess current species diversity within Antarctic waters. A major contributor in this were the Census of Antarctic Marine Life (CAML; http://www.caml.aq) and the Census of Diversity of Abyssal Marine Life (CeDAMar: http://www.coml.org/projects/census-diversity-abyssal-marine-life-cedamar) campaigns [5]. This project led to substantial systematic investigations into the biodiversity and biogeography of marine animals within the Southern Ocean and Antarctic Islands using both traditional and molecular methods of species identification. Until relatively recently, there were limited DNA barcodes, short sequences of DNA from a single organism, available for Antarctic marine species. In 2009, Grant & Linse [6] documented that genetic data were only available for 2.6% of marine invertebrate species. Although the number of Antarctic DNA barcodes is rising, increasing from 432 to 20 355 between 2009 and 2011 [7], the majority of these sequences originate from Molluscan and Crustacean species collected from the Weddell Sea and the Antarctic Peninsula.
Accurate documentation of species diversity is the primary step in understanding the patterns and controls of diversity levels, biogeography and functional ecology—all of which are fundamentally important to the management of marine ecosystems. Ecosystem-based management has been practised in Antarctica to regulate its fisheries since the early 1980s regulated by the Commission for the Conservation of Antarctic Marine Living Resources (CCAMLR) [8]. For management practices to be most effective, they should be based on sound scientific research and high-quality data. For example, the assignment of any marine protected areas should be based on a combination of diversity, productivity, bathymetric and habitat data to ensure protection of the most ecologically important or vulnerable locations in a variety of settings. The capacity of managing human impacts on Antarctic marine ecosystems can thus increase by continuing the research objectives set out by CAML [9,10].
The use of DNA barcodes to identify Antarctic fauna has uncovered previously overlooked cryptic species, those that are morphologically indistinguishable but genetically distinct, which appear to be a common feature within the Antarctic benthos [7]. Genetic analysis has also identified areas within the Southern Ocean such as the Scotia Arc as potential hotspots of cryptic diversity [11]. This is perhaps not surprising given the isolated nature and glacial history of Antarctic waters, which could have separated populations, promoting genetic divergence and cryptic speciation by reproductive isolation [11]. It has been proposed that the ecological impacts of repeated glacial and interglacial cycles could act as a speciation driver [12,13]. Ice advances during glacial maxima physically remove most of the marine benthos inhabiting the continental shelf by depositing it on to the continental slope within glacial debris. Thus, for species to persist through these glacial periods they would have had to survive within the deep sea or have shelf refugia within areas of no sea ice, such as polynyas [14,15]. During glacial maxima gene flow between populations would have been lower leading to increased genetic variation between populations. Under extreme environmental conditions, there may be increased selection pressures on behaviour and physiological character rather than functionality, thus reducing or eliminating morphological changes that can accompany speciation [16]. So assuming the functionality of the isolated populations remained constant, it is probably that their morphology would have gone unchanged, potentially resulting in high levels of cryptic species. To date, evidence of cryptic species has been documented in several Antarctic marine taxa including crustaceans [17,18], molluscs [11,19], polychaetes [20,21], echinoderms [22,23] and nemerteans [24].
Polychaetes represent one of the dominant taxa in benthic marine communities including Antarctic waters where they can account for more than 70% of macrofauna (organisms retained in a 300 µm sieve) [25,26] with recorded abundances of more than 300 individuals per 0.1 m2 [27]. As discussed in a recent review by Nygren [28], there is evidence to suggest that cryptic species are common among all polychaete families, making up a significant portion of their biodiversity. Whether or not cryptic species are more prevalent within certain polychaete families, functional groups or environments is, however, unknown. For this reason, the use of molecular methods for accurate identification of morphologically distinct and cryptic polychaete species is essential if we are to understand their true diversity. The first major comprehensive DNA barcoding project of polychaetes was conducted by Carr et al. [29], who sequenced 1876 specimens from waters surrounding Alaska and the Canadian Artic. In total, 25% of the morphospecies examined were composed of two or more distinct genetic lineages and deemed to contain cryptic species. Results such as this suggest that polychaete identification based on morphological characters alone may significantly underestimate species diversity.
Here, we present mitochrondrial DNA sequences from 15 polychaete morphospecies collected during British Antarctic Survey (BAS) expeditions in the western Antarctic region including the Scotia Arc, the Amundsen Sea Embayment and Pine Island Bay and the southeastern Weddell Sea. Using DNA sequences of two mitochondrial DNA loci, we assess the level of cryptic diversity of polychaetes. More specifically, we use these data to (i) re-evaluate levels of species diversity in Southern Ocean polychaetes using molecular techniques, (ii) discuss whether general rules can be applied to detect cryptic species in polychaetes, e.g. is there a consistent level of genetic difference between cryptic species that could be used to identify them in the future, and (iii) compare the use of the mitochondrial COI and 16S regions as barcoding genes for polychaetes. We use these findings to evaluate our overarching hypothesis that the level of polychaete diversity within the Southern Ocean is currently underestimated based on morphological species identification.
2. Material and methods
2.1. Sample collection
Specimens were collected using both an epibenthic sledge (EBS) and Agassiz trawl (AGT), between depths of 100 to 3500 m during expeditions JR144, JR179 (BIOPEARL I and II, Biodiversity Dynamics: Phylogeography, Evolution and Radiation of Life) and JR275 with RRS James Clark Ross (JR). Specific sampling protocols and preservation procedures used are described in Neal et al. [20] for EBS and Griffiths et al. [30] for AGT. Specimens from a total of 16 sites across the western Antarctic area were used including 6 sites within the Scotia Arc (BIOPEARL I), 4 sites within the Amundsen Sea (BIOPEARL II) and 6 sites within the Weddell Sea (JR275), (figure 1).
2.2. Morphological species identification
All individual polychaetes collected during BIOPEARL I and II and individuals of the selected target species from JR275 were identified from morphological characters by the same taxonomist. Where possible, individuals were assigned to named species using published dichotomous keys; however, in many cases species lacked description and were assigned a morphological operational taxonomic unit at the highest identifiable taxonomic level, i.e. some could be resolved to genus level, e.g. Flabelligena sp. A and Flabelligena sp. B, whereas others were only identifiable to family level, e.g. Polynoidae sp. A.
2.3. Specimen selection for DNA barcoding
The selection of target species for DNA barcoding was a non-random process; it was based on an informed combination of methodological requirements and research considerations. Approximately half the BIOPEARL polychaete individuals were fixed in formalin, which is known to denature DNA. Thus, those preserved in ethanol were chosen in order to limit preservation effects of sequence quality. The next major consideration when choosing target species was numbers of specimens. As multiple individuals are needed to detect cryptic species, we excluded all species with less than 10 individuals preserved in ethanol. From the remaining individuals, target species were chosen based on their taxonomic groups, functional traits and biogeographic distributions. We aimed to cover a range of these criteria as current knowledge on the prevalence of cryptic species across polychaete families and functional groups is limited. In total, 15 polychaete morphospecies (figure 2) were selected from the 400 available covering 12 out of the 28 families present in the sample set.
2.4. DNA extraction and sequencing
The selection of the part of each specimen to dissect for DNA extraction varied between families depending on their most useful taxonomic characteristics, in order to allow for possible re-examination of specimen morphology after DNA sequencing. For example, parapodia were taken from Polynoidae specimens, mid-body segments from Glyceridae and ventral tissue from Nephtyidae. DNA was extracted using a Qiagen DNeasy Blood and Tissue kit. Of the 463 DNA extractions, 131 were extracted using individual spin columns following the protocol provided by the manufacturer and the remaining 332 extracted by the Natural History Museum Sequencing Facility using a Hamilton Microlab STAR Robotic Workstation.
Part of the mitochondrial protein-coding COI (the so-called ‘Folmer fragment’, around 660 bp) gene was the primary gene targeted for this project. The COI gene was chosen as it is the gene required for formal barcode status on the Barcode of Life Data System (BOLD). The COI gene is a suitable barcoding gene as it is fast evolving and exhibits a greater degree of genetic distance between than within species [31]. However, with the increase in sequencing projects across all taxa, it is now becoming apparent that COI is not always the most attainable, and other mitochondrial genes can be used. Following variable PCR success with COI primers in this project for many target species the non-coding mitochondrial 16S rDNA gene (around 500 bp) was also targeted. This gene can be used in a similar way to COI for species discrimination [32,33], it is often easier to obtain and, in the case of Antarctic invertebrates, most widely available [6].
DNA extractions were amplified using a PCR mix of 21 µl Red Taq DNA Polymerase 1.1X MasterMix (VWR), 1 µl of each primer (10 µM) and 2–5 µl of DNA extract. The PCR temperature profile consisted of an initial 5 min denaturation stage at 95°C, followed by 35 cycles of 95°C denaturation for 1 min, 55°C annealing for 1 min, 74°C extension for 2 min with an additional 5 min extension phase after the last cycle. For primer sequences and references, see table 1. PCR products were purified using a Millipore Multiscreen 96-well PCR purification system and sequenced on an ABI 3730XL DNA Analyser (Applied Biosystems) at the Natural History Museum Sequencing Facility using the same primers as in the PCR.
primer name | sequence (5′-3′) | reference |
---|---|---|
LCO | GGTCAACAAATCATAAAGATATTGG | Folmer et al. [34] |
HCO | TAAACTTCAGGGTGACCAAAAA ATCA | Folmer et al. [34] |
CO1-E | TATACTTCTGGGTGTCCGAAGAATCA | Carr et al. [29] |
polyLCO (F) | GAYTATWTTCAACAAATCATAAAGATATTGG | Carr et al. [29] |
polyHCO (R) | TAMACTTCWGGGTGACCAAARAATCA | Carr et al. [29] |
polyshortCOIR (R) | CCNCCTCCNGCWGGRTCRAARAA | Carr et al. [29] |
Ann16Sr | TCCTAAGCCAACATCGAGGTGCCAA | Sjölin et al. [36] |
Ann16Sf | GCGGTATCCTGACCGTRCWAAGGTA | Sjölin et al. [36] |
2.5. Sequence analysis
Overlapping sequences (from forward and reverse primers) were assembled into consensus sequences and aligned in Geneious. 7.1.4 [37]. For phylogenetic analysis, additional sequences from the same, or when limited, closely related families, were downloaded from GenBank (http://www.ncbi.nlm.nih.gov/genbank/). For some species, additional COI sequences were also included from private databases within BOLD (http://www.barcodeoflife.org/). COI sequences were aligned using MUSCLE [38] and 16S using MAFTT [39] both using the default settings and provided as plug-ins in Geneious. At least one outgroup was chosen for each alignment; the species were selected from either a sister taxa or family within the same order. If available the choice of outgroups for some families was also inferred from previously published phylogenies.
Bayesian phylogenetic analyses were conducted for each morphospecies investigated using the separate 16S dataset and, where possible, the separate COI dataset. For each dataset, the best nucleotide substitution model was chosen using the jModelTest Akaike and Bayesian information criterion [40]. Either GTR + I + G or GTR + G models were chosen as the best-fit model for each alignment. All analyses were run three times for 10 000 000 generations using MrBayes v. 3.1.2 [41] with 2 500 000 generations discarded as burn-in. All phylogenetic trees were edited in FigTree v. 1.4 [42] and Adobe Illustrator CS5.1.
The inclusion of publicly available sequences of closely related species allowed the comparison of genetic distances between potential cryptic species and known morphologically described species. Thus, if the genetic distances were greater than or comparable to the genetic distances between known species, this provided evidence for the presence of cryptic species. For this, the Kimura's two-parameter substitution model (K2P) [43] was calculated using Mesquite [44] for pairwise comparisons of sequence divergence within and between species based on the number of nucleotide substitutions.
2.6. Secondary morphological analysis
Following DNA analysis, all individuals within the same morphospecies that appeared to be genetically distinct from one another were re-examined. Some specimens were also sent to taxonomic specialists, for example the targeted morphospecies within the families Nephtyidae and Maldanidae. Following both sequence and secondary morphological analysis, some specimens were reassigned to different morphospecies including both described species and undescribed morphospecies, while others were considered to still be true cryptic species in which clear morphological differences were not easily identified.
2.7. Operational taxonomic units
Throughout our analyses a phylogenetic species concept was used. This works on the principle that the genetic variation between species (interspecific) is greater than the genetic variation within species (intraspecific) [45]. Thus, where two or more species are distinct, there should be a lack of overlap between intraspecific and interspecific sequence variation, commonly referred to as the ‘barcoding gap’ [46]. Potential cryptic species were identified based on phylogenetic analysis; cryptic clades were determined from tree topography and the clade formation of the sequenced morphospecies in comparison to other known morphospecies and cryptic species within each family. K2P percentages were used as a secondary tool for identification, comparing interspecific and intraspecific genetic variation and the existence of a ‘barcoding gap’ once clades were determined.
All potential species (both morphological and cryptic) were labelled with the first author's initials (MB), if multiple species were found they were also assigned a unique number. Species that exhibited multiple clades which could not be resolved owing to high intraspecific variation, were considered to be a ‘species complex’ as well-supported phylogenetic species could not be resolved. Clades within a species complex were assigned the same MB# with an additional letter specific to their clade. For example, MB1a and MB1b would be different clades of the same species, while MB1 and MB2 are two separate cryptic species.
3. Results
In general, the phylogenetic results followed one of four scenarios: (1) evidence of cryptic species based on coherent COI and 16S phylogenies or if COI was not sequenced just 16S data, e.g. Scalibregma inflatum (figure 3); (2) evidence of cryptic species in the COI phylogeny but not 16S, e.g. Hesionidae sp. A (figure 4); (3) undetermined clades from 16S analysis, in this case we were unable to distinguish between the presence of potential cryptic species or high intraspecific variation within a species complex, e.g. Lumbrineris kerguelensis-cingulata (figure 5); (4) no evidence of cryptic species, e.g. Laonice weddellia.
3.1. Evidence of cryptic species based on coherent COI and 16S phylogenies
The presence of 10 potential cryptic species was recorded within eight of the 15 morphospecies sequenced. In six cases, these could be identified using both COI and 16S phylogenies. These included Glycera capitata, Scalibregma inflatum, Macellicephala sp. A, Aricidea belgicae (previously identified as A. simplex), Euphrosinella cirratoformis and Maldane sarsi. The number of cryptic species uncovered within each morphospecies ranged from one to three (table 2), and the majority of the cryptic species in this study were co-occurring within the same localities. For G. capitata, S. inflatum (figure 3) and Macellicephala sp. A, evidence of cryptic diversity could be identified from both COI and 16S phylogenetic and distance analysis. In each of these cases, the clade groupings were consistent across the two genes and the intraspecific and interspecific variation inferred from the K2P distance percentage was consistently greater in COI than 16S (figure 6).
primary species identification | secondary species identification | evidence of cryptic species | number of COI sequences | number of 16S sequences | GenBank accession numbers (COI) | GenBank accession numbers (16S) |
---|---|---|---|---|---|---|
Flabelligena sp. A (Acrocirridae) | Flabelligena sp. A (MB) | no | 8 | 12 | KX867405-7412 | KX867212-7223 |
Flabelligena sp. B (Acrocirridae) | Flabelligena sp. B (MB) | no | 2 | 8 | KX867413-7414 | KX867224-7231 |
Chaetozone sp. A (Cirratulidae) | Chaetozone sp. (MB1a) | no | — | 7 | — | KX867175-7181 |
Chaetozone sp. (MB1b) | — | 1 | — | KX867182 | ||
Chaetozone sp. (MB1c) | — | 2 | — | KX867183-7184 | ||
Euphrosinella cirratoformis (Euphrosinidae) | Euphrosinella cf. cirratoformis (MB1) | yes | — | 10 | — | KX867192-7201 |
Euphrosinella cf. cirratoformis (MB2) | — | 3 | — | KX867202-7204 | ||
Euphrosinopsis cf. antarctica (MB) | no | — | 2 | — | KX867205-7206 | |
Glycera capitata (Glyceridae) | Glycera sp. (MB1) | yes | 4 | 15 | KX867392-7395 | KX867232-7246 |
Glycera sp. (MB2) | 9 | 17 | KX867396-7404 | KX867247-7263 | ||
Hesionidae sp. A (Hesionidae) | Hesionidae sp. (MB1) | yes | 5 | 24 | KX867421-7425 | KX906540-6562 |
Hesionidae sp. (MB2) | 8 | KX867426-7433 | ||||
Lumbrineris kerguelensis-cingulata (Lumbrineridae) | Lumbrineris kerguelensis-cingulata (MB1a) | no | — | 5 | — | KX867315-7319 |
Lumbrineris kerguelensis-cingulata (MB1b) | — | 1 | — | KX867320 | ||
Lumbrineris kerguelensis-cingulata (MB1c) | — | 5 | — | KX867321-7325 | ||
Lumbrineris kerguelensis-cingulata (MB1d) | — | 2 | — | KX867326-7327 | ||
Lumbrineris kerguelensis-cingulata (MB1e) | — | 1 | — | KX867328 | ||
Lumbrineris kerguelensis-cingulata (MB1f) | — | 2 | — | KX867329-7330 | ||
Maldane sarsi (Maldanidae) | Asychis amphiglyptus (MB) | no | — | 4 | — | KX867171-7174 |
Eupraxillella cf. antarctica (MB) | no | — | 5 | — | KX867207-7211 | |
Maldane sarsi antarctica (MB) | yes | — | 2 | — | KX867345-7346 | |
Maldanidae sp. (MB) | no | — | 1 | — | KX867347 | |
Praxillella sp. (MB) | no | — | 1 | — | KX867348 | |
Aglaophamus trissophyllus (Nephtyidae) | Aglaophamus cf. trissophyllus (MB1a) | yes | 3 | 8 | KX867389-7391 | KX867140-7147 |
Aglaophamus trissophyllus (MB1b) | 2 | KX867381-7382 | ||||
Aglaophamus cf. trissophyllus (MB1c) | 1 | KX867383 | ||||
Aglaophamus sp. (MB2) | 3 | 22 | KX867384-7386 | KX867117-7121 | ||
Aglaophamus sp. (MB3) | 2 | KX867387-7388 | KX867123-7139 | |||
Aglaophamus sp. (MB4) | no | — | 1 | — | KX867122 | |
Aricidea simplex (Paraonidae) | Aricidea simplex (MB) | no | — | 9 | — | KX867162-7170 |
Aricidea cf. belgicae (MB1) | yes | — | 10 | — | KX867148-7157 | |
Aricidea cf. belgicae (MB2) | — | 2 | — | KX867158-7159 | ||
Aricidea cf. belgicae (MB3) | — | 1 | — | KX867160 | ||
Aricidea cf. pulchra (MB) | no | — | 1 | — | KX867161 | |
Harmothoe fuligineum (Polynoidae) | Harmothoe fuligineum (MB) | no | 6 | 15 | KX867415-7420 | KX867264-7278 |
Macellicephala sp. A (Polynoidae) | Macellicephala sp. (MB1) | yes | 3 | 9 | KX867445-7447 | KX867369-7377 |
Macellicephala sp. (MB2) | 1 | 3 | KX867448 | KX867378-7380 | ||
Macellicephaloides sp. B (Polynoidae) | Macellicephaloides sp. (MB1a) | no | — | 12 | — | KX867331-7342 |
Macellicephaloides sp. (MB1b) | — | 2 | — | KX867343-7344 | ||
Scalibregma inflatum (Scalibregmatidae) | Scalibregma sp. (MB1) | yes | 6 | 14 | KX867449-7454 | KX867349-7362 |
Scalibregma sp. (MB2) | 1 | 1 | KX867455 | KX867363 | ||
Scalibregma sp. (MB3) | 3 | 4 | KX867455-7458 | KX867364-7367 | ||
Laonice weddellia (Spionidae) | Laonice weddellia (MB) | no | 7 | 23 | KX867437-7444 | KX867292-7314 |
Laonice cf. antarctica (MB) | no | 2 | 6 | KX867434-7435 | KX867279-7284 | |
Laonice cf. vieitezi (MB) | no | 0 | 5 | — | KX867285-7289 |
For Aricidea belgicae, Euphrosinella cirratoformis and Maldane sarsi no COI sequences were collected and thus the evidence for cryptic species is purely from 16S sequence analysis. The K2P intraspecific and interspecific variation recorded was variable for each morphospecies. For example in E. cirratoformis, the average K2P between the two clades was 6.28%, much greater than the 2.31% difference between the three Aricidea clades (figure 6). Despite these lower values between the A. belgicae clades, these were still considered potential cryptic species as the genetic distance between A. belgicae and different morphotypes within the same genus were similar (electronic supplementary material, table S1).
3.2. Evidence of cryptic species in the COI phylogeny only
The recognition of potential cryptic species as opposed to intraspecific variation became more complex when single gene COI and 16S analyses produced different results (scenario 2 described above). Such difference between COI and 16S has previously been recorded in the Antarctic polychaete Austrolaenilla antarctica [20]. In our study, Aglaophamus trissophyllus COI analysis revealed the presence of five different clades, while 16S only revealed two of these (table 2). After examining the inter- and intra-clade K2P distances across the five COI clades, three clades were considered to be a potential species complex (MB1a–c), as defined in our methods, rather than cryptic species. The interspecific differences between this species complex and the two remaining Aglaophamus sp. clades (MB2–3) identified from COI analysis ranged from 11 to 14% (electronic supplementary material, table S1), thus these were considered to be cryptic species (table 2). When the interspecific and intraspecific variation of the corresponding 16S was measured there was no clear barcoding gap, although the average interspecific distance was greater than the intraspecific, 2.28% compared with 0.25%, (figure 6).
Similarly for Hesionidae sp. A, differences in the number of clades produced by COI and 16S were not coherent. Once more it was 16S that produced the more conserved diversity results, with only COI providing evidence for cryptic species. The corresponding 16S sequences from the specimens within different COI clades are labelled in figure 4, demonstrating that without COI for comparison these cryptic species would not have been identified. Thus, for those specimens morphologically identified as Hesionidae sp. A with no COI sequence it was not possible to assign them to cryptic clades observed in COI and they are labelled Hesionidae sp. (MB).
3.3. Undetermined clades from 16S analysis
In two of the target species, Lumbrineris kerguelensis-cingulata and Chaetozone sp. A, phylogenetic and distance analyses were unable to resolve whether the clades formed were potential cryptic diversity or a result of the morphospecies being a species complex [47]. This uncertainty was a combination of tree topography, overlapping inter- and intra-clade K2P distances and lack of COI data (electronic supplementary material, table S1), which may have revealed greater genetic distances (figures 5 and 6). Previous investigations have uncovered subtle morphological variations within these genera and have also suggested the existence of species complexes [47–49]. Furthermore, many of the specimens were incomplete. Given the high genetic diversity and associated taxonomic uncertainties, it is perhaps impossible to consider them as cryptic species as the missing material may contain morphological features that deem them separate morphospecies. Thus, a conservative approach to estimating species diversity was taken. Given the high intraspecific clade variation (up to 15.54%) in Lumbrineris kerguelensis-cingulata, it is likely that this complex contained a mixture of different morphospecies and possibly cryptic species. However, given the material and data available, we are unable to resolve this in this study.
3.4. No evidence of cryptic species
There was no convincing evidence of cryptic diversity in six of the original target species. For these species, the majority of individuals were contained within a single clade with generally low K2P distances in pairwise comparisons. Less than 1% intraspecific variation on average was recorded for both COI and 16S, in five of these six species (figure 6). These included well-known Antarctic species; Laonice weddellia and Harmothoe fuligineum as well as the two undescribed Acrocirridae species; Flabelligena sp. A and Flabelligena sp. B. For Aricidea simplex and the undescribed Polynoidae species Macellicephaloides sp. B only 16S sequences were obtained. Given the faster mutation rate of COI, it is not beyond possibility that if this gene was obtained, greater variation would have been recorded. However, using the data available there is no suggestion of cryptic diversity within these clades.
3.5. GenBank comparisons
By comparison to publicly available sequences on GenBank the Antarctic specimens morphologically identified as the described Northern Hemisphere species, Glycera capitata and Scalibregma inflatum, were shown to be cryptic species. In the case of Glycera sp. (MB2), these sequences matched Glycera ‘clade II’ sequences on GenBank, a previously identified cryptic species of G. capitata found within the Weddell Sea [21]. It also confirmed the presence of Harmothoe fuligineum and Aglaophamus trissophyllus within the BIOPEARL and JR275 samples by comparison to GenBank sequences obtained from other Antarctic specimens. Several larval DNA sequences collected from specimens in the Ross Sea matched BIOPEARL morphospecies, including two Laonice species and Hesionidae sp. A [50,51]. The comparison to sequences on GenBank also revealed genetic differences between Antarctic subspecies and their Northern parent species. In the case of Maldane sarsi, following DNA barcoding of the BIOPEARL specimens and taxonomic discussion, these individuals were assigned to the subspecies M. sarsi antarctica. This questions the usefulness of its subspecies status, if the subspecies are both genetically distinct from and located a significant distance from its parent species, we query whether they are actually separate morpho- or cryptic species.
3.6. Secondary morphological findings
As listed in table 2, secondary morphological analysis led to some individuals being reassigned to different morphospecies owing to initial taxonomic oversight and thus the genetic differences found during phylogenetic analysis were not a result of ‘true’ cryptic diversity but rather primary misidentification. In total, 10 additional morphospecies were identified within five of the original morphospecies. These were found in the following species; Laonice weddellia, which contained two other Antarctic Laonice species including Laonice cf. vieitezi and L. cf. antarctica; Maldane sarsi which contained two unidentifiable species as well as Asychis amphiglyptus and Eupraxillella cf. antarctica; Aricidea simplex which contained mostly A. belgicae specimens and a single A. cf. pulchra specimen; Euphrosinella cirratoformis which contained several Euphrosinopsis cf. antarctica specimens; and Aglaophamus trissophyllus which also contained an unidentifiable Aglaophamus species (Aglaophamus sp. (MB4)).
4. Discussion
Using DNA barcoding, the number of species within our subsample increased by 233% from 15 to 35. This was a result of 10 additional cryptic species identified within half of the target species and 10 additional morphospecies uncovered during secondary morphological examination. This suggests that using routine morphological identification, with the rather inadequate taxonomic sources available, collectors are missing an astonishing amount of Southern Ocean biodiversity. In each case of suspected cryptic species, the results were discussed with specialist taxonomists for specific polychaete families and previous taxonomic findings were considered. The efficiency of detecting cryptic diversity would be much greater if general rules could be applied. For example, a minimum of 10 times the average intraspecific variation between clade differences has been suggested as a rule of thumb for identifying cryptic species [52]. This method was used to identify provisional species in a major polychaete barcoding project [29]. Using the COI marker, Carr et al. [29] detected cryptic species in more than 25% of the species investigated with on average 16.5% sequence divergence between species and 0.68% within species. In our study, the interspecific variation between cryptic clades for COI sequences was on average at least 20 times greater than the intraspecific variation (figure 6). For 16S, this difference was lower ranging from 9 to 28 times more interspecific than intraspecific variation. These results indicate that our ability to apply strict rules to the identification of cryptic species within polychaetes is limited. A lack of evidence for a global DNA barcoding gap in Annelida was also recorded in Kvist [53], who evaluated over 70 million pairwise genetic comparisons using the Automated Barcoding Gap Discovery software [54]. Where possible, a number of genes and phylogenetic analyses should be used when determining the presence of cryptic species.
These data contribute to the growing body of evidence which suggests that the Antarctic benthos is far more species rich than previously thought [2,55]. The first major review of Southern Ocean deep-sea diversity by Brandt et al. [56] noted that a high proportion of species were considered new to science, many of which were also considered to be Southern Ocean endemics and rare. At the time, these data were sufficient to provide a sound basis to conserve the Southern Ocean as a fragile marine environment. At the same time, there was also a growing number of genetic datasets presenting evidence for cryptic species, in addition to ongoing speciation in some taxa [57]. As previously stated, cryptic diversity has now been documented in all major invertebrate taxa within the Southern Ocean; however, most of these studies only investigate a single genus or species. An exception to this is the study by O'Loughlin et al. [58] investigating the genetic diversity of 28 holothurian morphospecies. Within this study, an average of three divergent lineages were uncovered in 17 of the 28 morphospecies targeted, thereby significantly increasing species richness.
The presence of cryptic species among Antarctic fauna suggests that genetic differentiation between populations may have been driven by multiple factors. The aforementioned glacial history of Antarctica creating physical barriers between populations and thus preventing reproductive exchange is currently believed to be the most likely explanation of cryptic speciation [2]. It has often been predicted that cryptic species result from, and are more abundant in, widely distributed species with direct development or short-lived larvae [59]. Given the abundance of invertebrate species lacking a planktonic larval phase in Antarctica [60], it could be suggested that cryptic species may be more abundant in Antarctica as a result of the combined influences of both environmental and biological factors. With the exception of a few chemosynthetic species (e.g. Glover et al. [61], McHugh [62], Van Dover et al. [63]) our knowledge of the reproductive traits of deep-sea polychaetes is perhaps too limited to consider such traits as potential speciation drivers. For most polychaetes, their reproductive traits (e.g. whether species are brooders or spawners, if they have larval stages and whether these are feeding or non-feeding) are generally classified at the family level from studies based on shallow-water species. In our study, there is a mixture of reproductive modes within species containing cryptic clades [64], and so we are unable to predict whether family-level traits could have promoted genetic divergence. These findings are consistent with that of Nygren [28]; in this review it was concluded that no generalizations can be made about which type or types of polychaetes could be more likely to contain cryptic species given their existence across varying life histories and environments.
The geographical and depth distribution of the different cryptic clades and potential species identified within this study are yet to be investigated (Brasier et al. [65]), although some biogeographic implications of these data are already evident. The presence of cryptic Antarctic clades within morphospecies described from the Northern Hemisphere including Glycera capitata, Scalibregma inflatum and Maldane sarsi indicates that we should be questioning the current ‘usual’ identifications of cosmopolitan polychaete species. To address such questions thoroughly would require the phylogenetic analysis incorporating DNA barcodes from type material, or if unavailable, specimens collected at their type locality, including Greenland (Glycera capitata), Norway (Scalibregma inflatum) and Sweden (Maldane sarsi). Genetic evidence for cosmopolitan polychaetes does exist. For example, the vestimentiferan tube worm Sclerolinum contortum has shown genetic consistency in the COI gene among specimens collected from both polar regions and the Gulf of Mexico [66]. However, for the majority of Antarctic species investigated widespread distribution and circumpolarity is rarely recorded and multiple species with more restricted ranges are more common [17,23,67–69].
With the increased abundance of geo-referenced DNA sequences generated from barcoding studies, the assessment of species distributions could not only provide insight into the drivers of this cryptic diversity but also assist in marine management and monitoring in regions undergoing ecosystem change, such as Antarctica. Furthermore, these data provide the baseline for future investigations into the importance of cryptic species at a functional level, species response to environmental variability and its impact on ecosystem function and services. The lack of morphological differences between them could suggest that cryptic clades remain functionally similar. However, in some taxa physiological experiments have revealed functional variability between cryptic species. For example, different growth rates have been recorded in cryptic clades of the phytoplankton Chaetoceros socialis under different temperature conditions [70] and in the marine protist Oxyrrhis marina when exposed to different salinities [71]. The dominance, coexistence and interspecific competition between cryptic species may also be variable under changing conditions as indicated by experiments on Rhabditis marina [72]. Differences in the natural products produced by cryptic clades of the bryozoa Bugula neritina have also been recorded [73]. Although such experiments on living specimens may not be possible for deep-sea polychaetes, if species-specific biological trait data were to be collected from preserved material this could provide insight into the importance of diversity at the functional level, i.e. role of diversity and cryptic diversity in maintaining ecosystem services in rapidly changing marine environments.
The comparison of DNA sequences in this project uncovered an underestimation of species diversity as a result of the presence of cryptic species, in addition to errors in morphological identification, which may be an additional contributing factor. Within five of the morphologically identified target taxa multiple morphospecies were identified during secondary morphological analysis. Previous misidentifications of several species within this study could have resulted from multiple factors. For example, the soft bodies of polychaetes can be easily damaged during sample processing. The resulting presence of incomplete specimens, especially those that have lost critical identifying features, reduces the accuracy of species identification [74]. An example of the latter in our study was found in Aricidea, where the median antenna present on Aricidea simplex (distinguishing it from A. belgicae) was detached in some cases leading to false identification prior to DNA sequencing. As seen for Laonice weddellia, genetically distinct clades were actually specimens of Laonice cf. vieitezi, which was described after the specimens in our study were first morphologically identified [74]. Finally, incorrect taxonomic decisions inherently associated with the processing of large numbers (around 20 000) of specimens in a limited time frame (ultimately defined by funding) may have also been an influencing factor. Furthermore, the EBS used to collect specimens targets smaller individuals, thus many morphospecies were juveniles, including Aglaophamus trissophyllus, with ontogenetic differences to their adult counterparts collected in the AGT. The secondary morphological examination after sequencing is therefore vitally important to prevent false positive results and an overestimation of ‘true’ cryptic diversity. The morphological differences identified during secondary analysis following DNA barcoding highlights that DNA barcoding should be considered a complementary method of species identification for diversity investigations rather than a replacement [75]. This is most important in species or families lacking reference sequences on public databases as DNA barcodes would not be able to connect individuals to a known species. Increased numbers of unidentified specimens limits the use of their sequences in future studies such as biogeography or for management tools.
The complementary results between the two mitochondrial genes 16S and COI in several morphospecies demonstrates that despite the slower evolutionary rates of 16S it can in many cases fulfil the barcode criteria set out by Hebert et al. [31]. Similar results have also been observed in other taxa including amphibians [33], crustaceans [18] and nudibranchs [76]. A greater abundance of publicly available 16S sequences compared to COI for Antarctic invertebrates was noted in Grant & Linse [6]. Furthermore, as recorded within family-level polychaete studies the retrieval of 16S is often more successful as seen for the Hesionidae [77] and Nephtyidae [78]. Thus, 16S should not be initially viewed as an inferior barcoding gene to COI. In many species, 16S provided greater specimen coverage without underestimating species diversity. However, the collection of both genes, at least from clade representatives, can aid in the discrimination between high intraspecific variation and potential cryptic species as observed for Hesionidae sp. A and Aglaophamus trissophyllus.
In conclusion, we can confidently accept the overarching hypothesis of this study as our data reveal that current levels of Antarctic polychaete diversity are vastly underestimated. There are nearly 800 species records of polychaetes within the Register of Antarctic Marine Species (RAMS), which have been documented in Antarctic waters [79]. The combined factors of undersampling, undescribed species and cryptic species suggest that true Antarctic species diversity for polychaetes will be far in excess of this figure. As for the general prevalence of cryptic species, given the uncertainties associated with the detection of cryptic species, including scientific opinion regarding their definition and identification, intraspecific variability and phylogenetic understanding, it is perhaps impossible to suggest the total prevalence of cryptic species within the currently recorded Antarctic polychaetes. In agreement with previous studies [28,29], there appear to be no patterns in cryptic diversity across families. However, other factors remain to be investigated, including biogeography and functional traits, which should be a primary focus of future barcoding projects. The results of this study contribute to the ongoing research effort to document, describe and understand the diversity, biogeography and functionality of Antarctic marine fauna. Such data are of the utmost importance for effective research-driven ecosystem-based management of the rapidly changing Antarctic marine ecosystem.
Ethics
Research followed all applicable laws and ethical guidelines per individuals' countries.
Data accessibility
All new sequence data have been deposited in the GenBank Database, accession numbers by species are listed in table 2.
Authors' contributions
This paper includes the main finding of the first chapter of M.J.B.'s PhD thesis. M.J.B. conducted all laboratory DNA data collection, led the analysis and wrote this manuscript. H.W. significantly contributed to the acquisition, analysis and interpretation of the genetic data. L.N. was the primary taxonomist identifying all BIOPEARL polychaetes and re-examined specimens following DNA sequencing. R.J. contributed to the conception of this project and manuscript editing. K.L. donated all of the specimens used in this project and assisted in the interpretation and discussion of the DNA data collected. H.R. contributed to hypothesis framing and manuscript editing. A.G.G. led the polychaete sampling at sea of the BIOPEARL II samples, and project-managed the sorting and identification of all BIOPEARL polychaetes. A.G.G. also conceived this part of M.J.B.'s PhD project, made a substantial contribution to its design and contributed to the interpretation of results. All authors contributed to the revised article and are accountable for all aspects of the work should the accuracy and integrity be questioned.
Competing interests
We have no competing interests.
Funding
All DNA barcoding was supported by M.J.B.'s PhD research training grant received from the University of Liverpool and the National Oceanography Centre. The expeditions JR144, JR179 (BIOPEARL I & II) and JR275 were part of the British Antarctic Survey core programmes ‘Global Science in the Antarctic Context’ and ‘Polar Science for Planet Earth‘ funded by the Natural Environment Research Council. A.G.G.'s participation in the JR179 research cruise was funded by the Natural Environment Research Council Collaborative Gearing Scheme.
Acknowledgements
We would like to thank the crew and scientists who participated in the three research cruises that collected the polychaete specimens used in this study. We are particularly grateful to the BIOPEARL sample sorters that worked at sea, in the NHM Deep Sea Lab, and the BAS Lab: Rebekah Baker, David Barnes, Stefanie Kaiser, Ondine Cornubert, Adam Reed, Michael Mende, Wencke Krings, Moritz Stäbler and Chester Sands. Additional thanks are due to the following polychaete taxonomists; Torkild Bakken (Norwegian University of Science and Technology), Jon Kongsrud (University of Bergen) and Ascensão Ravara (University of Aveiro) for assisting in the morphological identification of specific polychaete families. Final thanks to Jenna Brasier for her assistance in figure production.
References
- 1
Vaughan DG, Marshall GJ, Connolley WM, Parkinson C, Mulvaney R, Hodgson DA, King JC, Pudsey CJ, Turner J . 2003 Recent rapid regional climate warming on the Antarctic Peninsula. Clim. Change 60, 243–274. (doi:10.1023/A:1026021217991) Crossref, ISI, Google Scholar - 2
Chown SL, Clarke A, Fraser CI, Cary SC, Moon KL, McGeoch MA . 2015 The changing form of Antarctic biodiversity. Nature 522, 431–438. (doi:10.1038/nature14505) Crossref, PubMed, ISI, Google Scholar - 3
Clarke A, Murphy EJ, Meredith MP, King JC, Peck LS, Barnes DKA, Smith RC . 2007 Climate change and the marine ecosystem of the western Antarctic Peninsula. Phil. Trans. R. Soc. B 362, 149–166. (doi:10.1098/rstb.2006.1958) Link, ISI, Google Scholar - 4
Peck LS, Webb KE, Bailey DM . 2004 Extreme sensitivity of biological function to temperature in Antarctic marine species. Funct. Ecol. 18, 625–630. (doi:10.1111/j.0269-8463.2004.00903.x) Crossref, ISI, Google Scholar - 5
Schiaparelli S, Hopcroft RR . 2011 The census of Antarctic marine life: diversity and change in Southern Ocean ecosystems. Deep-sea Res. Part II Top. Stud. Oceanogr. 58, 1–4. (doi:10.1016/j.dsr2.2010.11.002) Crossref, ISI, Google Scholar - 6
Grant RA, Linse K . 2009 Barcoding Antarctic biodiversity: current status and the CAML initiative, a case study of marine invertebrates. Polar Biol. 32, 1629–1637. (doi:10.1007/s00300-009-0663-x) Crossref, ISI, Google Scholar - 7
Grant RA, Griffiths HJ, Steinke D, Wadley V, Linse K . 2011 Antarctic DNA barcoding; a drop in the ocean? Polar Biol. 34, 775–780. (doi:10.1007/s00300-010-0932-7) Crossref, ISI, Google Scholar - 8
Constable AJ, William K, Agnew DJ, Everson I, Miller D . 2000 Managing fisheries to conserve the Antarctic marine ecosystem: practical implementation of the Convention on the Conservation of Antarctic Marine Living Resources (CCAMLR). ICES J. Mar. Sci. 57, 778–791. (doi:10.1006/jmsc.2000.0725) Crossref, ISI, Google Scholar - 9
Hooker SK, Gerber LR . 2004 Marine reserves as a tool for ecosystem-based management: the potential importance of megafauna. Bioscience 54, 27–39. (doi:10.1641/0006-3568(2004)054[0027:MRAATF]2.0.CO) Crossref, ISI, Google Scholar - 10
Ruckelshaus M, Klinger T, Knowlton N, DeMaster DP . 2008 Marine ecosystem-based management in practice: scientific and governance challenges. Bioscience 58, 53–63. (doi:10.1641/B580110) Crossref, ISI, Google Scholar - 11
Linse K, Cope T, Lörz A-N,, Sands C . 2007 Is the Scotia Sea a centre of Antarctic marine diversification? Some evidence of cryptic speciation in the circum-Antarctic bivalve Lissarca notorcadensis (Arcoidea: Philobryidae). Polar Biol. 30, 1059–1068. (doi:10.1007/s00300-007-0265-3) Crossref, ISI, Google Scholar - 12
Clarke A, Crame JA . 1989 The origin of the Southern Ocean marine fauna. Geological Soc. Lond. Special Publications 47, 253–268. (doi:10.1144/GSL.SP.1989.047.01.19) Crossref, Google Scholar - 13
Clarke AJ, Crame JA . 1992 The Southern Ocean benthic fauna and climate change: a historical perspective. Phil. Trans. R. Soc. Lond. B 338, 99–109. (doi:10.1098/rstb.1992.0150) Link, ISI, Google Scholar - 14
Thatje S, Hillenbrand C-D, Larter R . 2005 On the origin of Antarctic marine benthic community structure. Trends Ecol. Evol. 20, 534–540. (doi:10.1016/j.tree.2005.07.010) Crossref, PubMed, ISI, Google Scholar - 15
Thatje S, Hillenbrand C-D, Mackensen A, Larter R . 2008 Life hung by a thread: endurance of Antarctic fauna in glacial periods. Ecology 89, 682–692. (doi:10.1890/07-0498.1) Crossref, PubMed, ISI, Google Scholar - 16
Bickford D, Lohman DJ, Sodhi NS, Ng PK, Meier R, Winker K, Ingram KK, Das I . 2007 Cryptic species as a window on diversity and conservation. Trends Ecol. Evol. 22, 148–155. (doi:10.1016/j.tree.2006.11.004) Crossref, PubMed, ISI, Google Scholar - 17
Havermans C, Nagy ZT, Sonet G, De Broyer C, Martin P . 2011 DNA barcoding reveals new insights into the diversity of Antarctic species of Orchomene sensu lato (Crustacea: Amphipoda: Lysianassoidea). Deep-sea Res. Part II Top. Stud. Oceanogr. 58, 230–241. (doi:10.1016/j.dsr2.2010.09.028) Crossref, ISI, Google Scholar - 18
Held C . 2003 Molecular evidence for cryptic speciation within the widespread Antarctic crustacean Ceratoserolis trilobitoides (Crustacea, Isopoda). In Antarctic biology in a global context, (edsHuiskes AH, Gieskes WW, Rozema RM, Schorno SM, van der Vies SM, Wolff WJ ), pp. 135–139. Leidon, The Netherlands: Backhuys Publishers. Google Scholar - 19
Allcock AL, Barratt I, Eléaume M, Linse K, Norman MD, Smith PJ, Steinke D, Stevens DW, Strugnell JM . 2011 Cryptic speciation and the circumpolarity debate: a case study on endemic Southern Ocean octopuses using the COI barcode of life. Deep-sea Res. Part II Top. Stud. Oceanogr. 58, 242–249. (doi:10.1016/j.dsr2.2010.05.016) Crossref, ISI, Google Scholar - 20
Neal L, Wiklund H, Muir AI, Linse K, Glover AG . 2014 The identity of juvenile Polynoidae (Annelida) in the Southern Ocean revealed by DNA taxonomy, with notes of the status of Herdmanella gracilis Ehlers sensu Augener. Mem. Mus. Vic. 71, 203–216. Crossref, Google Scholar - 21
Schüller M . 2011 Evidence for a role of bathymetry and emergence in speciation in the genus Glycera (Glyceridae, Polychaeta) from the deep Eastern Weddell Sea. Polar Biol. 34, 549–564. (doi:10.1007/s00300-010-0913-x) Crossref, ISI, Google Scholar - 22
Janosik AM, Halanych KM . 2010 Unrecognized Antarctic biodiversity: a case study of the Genus Odontaster (Odontasteridae; Asteroidea). Integr. Comp. Biol. 50, 981–992. (doi:10.1093/icb/icq119) Crossref, PubMed, ISI, Google Scholar - 23
Wilson N, Hunter R, Lockhart S, Halanych K . 2007 Multiple lineages and absence of panmixia in the ‘circumpolar’ crinoid Promachocrinus kerguelensis from the Atlantic sector of Antarctica. Mar. Biol. 152, 895–904. (doi:10.1007/s00227-007-0742-9) Crossref, ISI, Google Scholar - 24
Thornhill DJ, Mahon AR, Norenburg JL, Halanych KM . 2008 Open-ocean barriers to dispersal: a test case with the Antarctic Polar Front and the ribbon worm Parborlasia corrugatus (Nemertea: Lineidae). Mol. Ecol. 17, 5104–5117. (doi:10.1111/j.1365-294X.2008.03970.x) Crossref, PubMed, ISI, Google Scholar - 25
Gambi M, Castelli A, Guizzardi M . 1997 Polychaete populations of the shallow soft bottoms off Terra Nova Bay (Ross Sea, Antarctica): distribution, diversity and biomass. Polar Biol. 17, 199–210. (doi:10.1007/s003000050123) Crossref, ISI, Google Scholar - 26
Glover AG, Smith CR, Mincks SL, Sumida PYG, Thurber AR . 2008 Macrofaunal abundance and composition on the West Antarctic Peninsula continental shelf: evidence for a sediment ‘food bank’ and similarities to deep-sea habitats. Deep-sea Res. Part II Top. Stud. Oceanogr. 55, 2491–2501. (doi:10.1016/j.dsr2.2008.06.008) Crossref, ISI, Google Scholar - 27
Siciński J 2011 Admiralty Bay benthos diversity, a census of a complex polar ecosystem. Deep-sea Res. Part II Top. Stud. Oceanogr. 58, 30–48. (doi:10.1016/j.dsr2.2010.09.005) Crossref, ISI, Google Scholar - 28
Nygren A . 2014 Cryptic polychaete diversity: a review. Zool. Scr. 43, 172–183. (doi:10.1111/zsc.12044) Crossref, ISI, Google Scholar - 29
Carr CM, Hardy SM, Brown TM, Macdonald TA, Hebert PD . 2011 A tri-oceanic perspective: DNA barcoding reveals geographic structure and cryptic diversity in Canadian polychaetes. PLoS ONE 6, e22232. (doi:10.1371/journal.pone.0022232) Crossref, PubMed, ISI, Google Scholar - 30
Griffiths HJ, Linse K, Barnes DKA . 2008 Distribution of macrobenthic taxa across the Scotia Arc, Southern Ocean. Antarct. Sci. 20, 213–226. (doi:10.1017/S0954102008001168) Crossref, ISI, Google Scholar - 31
Hebert PD, Cywinska A, Ball SL., deWaard JR . 2003 Biological identifications through DNA barcodes. Phil. Trans. R. Soc. Lond. B 270, 313–321. (doi:10.1098/rspb.2002.2218) Abstract, Google Scholar - 32
Vences M, Thomas M, Bonett RM, Vieites DR . 2005 Deciphering amphibian diversity through DNA barcoding: chances and challenges. Phil. Trans. R. Soc. B 360, 1859–1868. (doi:10.1098/rstb.2005.1717) Link, ISI, Google Scholar - 33
Vences M, Thomas M, Van der Meijden A, Chiari Y, Vieites DR . 2005 Comparative performance of the 16S rRNA gene in DNA barcoding of amphibians. Front. Zool. 2, 5. (doi:10.1186/1742-9994-2-5) Crossref, PubMed, Google Scholar - 34
Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R . 1994 DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3, 294–299. PubMed, Google Scholar - 35
Bely AE, Wray GA . 2004 Molecular phylogeny of naidid worms (Annelida: Clitellata) based on cytochrome oxidase I. Mol. Phylogenet. Evol. 30, 50–63. (doi:10.1016/S1055-7903(03)00180-5) Crossref, PubMed, ISI, Google Scholar - 36
Sjölin E, Erséus C, Källersjö M . 2005 Phylogeny of Tubificidae (Annelida, Clitellata) based on mitochondrial and nuclear sequence data. Mol. Phylogenet. Evol. 35, 431–441. (doi:10.1016/j.ympev.2004.12.018) Crossref, PubMed, ISI, Google Scholar - 37
Kearse M 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28, 1647–1649. (doi:10.1093/bioinformatics/bts199) Crossref, PubMed, ISI, Google Scholar - 38
Edgar RC . 2004 MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792–1797. (doi:10.1093/nar/gkh340) Crossref, PubMed, ISI, Google Scholar - 39
Katoh K, Misawa K, Kuma K, Miyata T . 2002 MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 30, 3059–3066. (doi:10.1093/nar/gkf436) Crossref, PubMed, ISI, Google Scholar - 40
Posada D . 2008 jModelTest: phylogenetic model averaging. Mol. Bol. Evol. 25, 1253–1256. (doi:10.1093/molbev/msn083) Crossref, PubMed, ISI, Google Scholar - 41
Ronquist F, Huelsenbeck JP . 2003 MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. (doi:10.1093/bioinformatics/btg180) Crossref, PubMed, ISI, Google Scholar - 42
- 43
Kimura M . 1980 A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120. (doi:10.1007/BF01731581) Crossref, PubMed, ISI, Google Scholar - 44
Maddison WP, Maddison DR . 2016 Mesquite: a modular system for evolutionary analysis. Version 3.10. See http://mesquiteproject.org. Google Scholar - 45
Hebert PD, Ratnasingham S, de Waard JR . 2003 Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Phil. Trans. R. Soc. Lond. B 270, S96–S99. (doi:10.1098/rsbl.2003.0025) Abstract, Google Scholar - 46
Meyer CP, Paulay G, Godfray C . 2005 DNA barcoding: error rates based on comprehensive sampling. PLoS Biol. 3, e422. (doi:10.1371/journal.pbio.0030422) Crossref, PubMed, ISI, Google Scholar - 47
Orensanz JM . 1990 Biology of the Antarctic Seas XXI. Antarct. Res. Ser. 52, 1–183. (doi:10.1029/AR052p0001) Crossref, Google Scholar - 48
Blake JA, Blake J, Hilbig B, Scott P . 1996 Family Cirratulidae Ryckholdt, 1851. Including a revision of the genera and species from the eastern north Pacific. Taxonomic atlas of the benthic fauna of the Santa Maria Basin and the Western Santa Barbara Channel. 6, 263–384. Google Scholar - 49
Petersen ME . 1999 Reproduction and development in Cirratulidae (Annelida: Polychaeta). In Reproductive strategies and developmental patterns in Annelids, (edsDorresteijn AWC, Westheide W ), pp. 107–128. Dordrecht, The Netherlands: Springer. Crossref, Google Scholar - 50
Gallego R, Lavery S, Sewell M . 2014 The meroplankton community of the oceanic Ross Sea during late summer. Antarct. Sci. 26, 345–360. (doi:10.1017/S0954102013000795) Crossref, ISI, Google Scholar - 51
Heimeier D, Lavery S, Sewell MA . 2010 Using DNA barcoding and phylogenetics to identify Antarctic invertebrate larvae: lessons from a large scale study. Mar. Genomics. 3, 165–177. (doi:10.1016/j.margen.2010.09.004) Crossref, PubMed, ISI, Google Scholar - 52
Hebert PD, Stoeckle MY, Zemlak TS, Francis CM . 2004 Identification of birds through DNA barcodes. PLoS Biol. 2, e312. (doi:10.1371/journal.pbio.0020312) Crossref, PubMed, ISI, Google Scholar - 53
Kvist S . 2016 Does a global DNA barcoding gap exist in Annelida? Mitochondrial DNA 27, 2241–2252. (doi:10.3109/19401736.2014.984166) PubMed, Google Scholar - 54
Puillandre N, Lambert A, Brouillet S, Achaz G . 2012 ABGD, automatic barcode gap discovery for primary species delimitation. Mol. Ecol. 21, 1864–1877. (doi:10.1111/j.1365-294X.2011.05239.x) Crossref, PubMed, ISI, Google Scholar - 55
Clarke A, Johnston NM . 2003 Antarctic marine benthic diversity. Oceanogr. Mar. Biol. Annu. Rev. 41, 47–114. ISI, Google Scholar - 56
Brandt A, De Broyer C, De Mesel I, Ellingawn KE, Gooday AJ, Hilbig B, Linse K, Thomson MRA, Tyler PA . 2007 The biodiversity of the deep Southern Ocean benthos. Phil. Trans. R. Soc. B 362, 39–66. (doi:10.1098/rstb.2006.1952) Link, ISI, Google Scholar - 57
Baird HP, Miller KJ, Stark JS . 2011 Evidence of hidden biodiversity, ongoing speciation and diverse patterns of genetic structure in giant Antarctic amphipods. Mol. Ecol. 20, 3439–3454. (doi:10.1111/j.1365-294X.2011.05173.x) Crossref, PubMed, ISI, Google Scholar - 58
O'Loughlin MP, Paulay G, Davey N, Michonneau F . 2011 The Antarctic region as a marine biodiversity hotspot for echinoderms: diversity and diversification of sea cucumbers. Deep-sea Res. Part II Top. Stud. Oceanogr. 58, 264–275. (doi:10.1016/j.dsr2.2010.10.011) Crossref, ISI, Google Scholar - 59
Westheide W, Haß-Cordes E, Krabusch M, Müller M . 2003 Ctenodrilus serratus (Polychaeta: Ctenodrilidae) is a truly amphi-Atlantic meiofauna species—evidence from molecular data. Mar. Biol. 142, 637–642. (doi:10.1007/s00227-002-0960-0) Crossref, ISI, Google Scholar - 60
Marshall DJ, Krug PJ, Kupriyanova EK, Byrne M, Emlet RB . 2012 The biogeography of marine invertebrate life histories. Annu. Rev. Ecol. Evol. Syst. 43, 97. (doi:10.1146/annurev-ecolsys-102710-145004) Crossref, ISI, Google Scholar - 61
Glover AG, Goetze E, Dahlgren TG, Smith CR . 2005 Morphology, reproductive biology and genetic structure of the whale-fall and hydrothermal vent specialist, Bathykurila guaymasensis Pettibone, 1989 (Annelida: Polynoidae). Mar. Ecol. 26, 223–234. (doi:10.1111/j.1439-0485.2005.00060.x) Crossref, ISI, Google Scholar - 62
McHugh D . 1989 Population structure and reproductive biology of two sympatric hydrothermal vent polychaetes, Paralvinella pandorae and P. palmiformis. Mar. Biol. 103, 95–106. (doi:10.1007/BF00391068) Crossref, ISI, Google Scholar - 63
Van Dover CL, Trask J, Gross J, Knowlton A, Van Dover C . 1999 Reproductive biology of free-living and commensal polynoid polychaetes at the Lucky Strike hydrothermal vent field (Mid-Atlantic Ridge). Mar. Ecol. Prog. Ser. 181, 201–214. (doi:10.3354/meps181201) Crossref, ISI, Google Scholar - 64
Faulwetter MS 2014 Polytraits: a database on biological traits of marine polychaetes. Biodivers. Data J. 2, e1024. (doi:10.3897/BDJ.2.e1024) Crossref, Google Scholar - 65
Brasier MJ, Harle J, Ruhl H, Wiklund H, Linse K, Jeffreys RM, Glover AG . In preparation. Circum-Antarctic sympatric polychaetes, examples of widespread cryptic species. Google Scholar - 66
Georgieva MN, Wiklund H, Bell JB, Eilertsen MH, Mills RA, Little CTS, Glover AG . 2015 A chemosynthetic weed: the tubeworm Sclerolinum contortum is a bipolar, cosmopolitan species. BMC Evol. Biol. 15, 1–17. (doi:10.1186/s12862-015-0559-y) Crossref, PubMed, ISI, Google Scholar - 67
Arango CP, Soler-Membrives A, Miller KJ . 2011 Genetic differentiation in the circum—Antarctic sea spider Nymphon australe (Pycnogonida; Nymphonidae). Deep-sea Res. Part II Top. Stud. Oceanogr. 58, 212–219. (doi:10.1016/j.dsr2.2010.05.019) Crossref, ISI, Google Scholar - 68
Raupach MJ, Malyutina M, Brandt A, Wägele J-W . 2007 Molecular data reveal a highly diverse species flock within the munnopsoid deep-sea isopod Betamorpha fusiformis (Barnard, 1920) (Crustacea: Isopoda: Asellota) in the Southern Ocean. Deep-sea Res. Part II Top. Stud. Oceanogr. 54, 1820–1830. (doi:10.1016/j.dsr2.2007.07.009) Crossref, ISI, Google Scholar - 69
Riesgo A, Taboada S, Avila C . 2015 Evolutionary patterns in Antarctic marine invertebrates: an update on molecular studies. Mar. Genomics 23, 1–13. (doi:10.1186/1471-2148-14-3) Crossref, PubMed, ISI, Google Scholar - 70
Degerlund M, Huseby S, Zingone A, Sarno D, Landfald B . 2012 Functional diversity in cryptic species of Chaetoceros socialis Lauder (Bacillariophyceae). J. Plankton Res. 34, 416–431. (doi:10.1093/plankt/fbs004) Crossref, ISI, Google Scholar - 71
Lowe CD, Day A, Kemp SJ, Montagnes DJ . 2005 There are high levels of functional and genetic diversity in Oxyrrhis marina. J. Eukaryot. Microbiol. 52, 250–257. (doi:10.1111/j.1550-7408.2005.00034.x) Crossref, PubMed, ISI, Google Scholar - 72
De Meester N, Derycke S, Bonte D, Moens T . 2011 Salinity effects on the coexistence of cryptic species: a case study on marine nematodes. Mar. Biol. 158, 2717–2726. (doi:10.1007/s00227-011-1769-5) Crossref, ISI, Google Scholar - 73
Davidson SK, Haygood MG . 1999 Identification of sibling species of the bryozoan Bugula neritina that produce different anticancer bryostatins and harbor distinct strains of the bacterial symbiont ‘Candidatus Endobugula sertula’. Biol. Bull. 196, 273–280. (doi:10.2307/1542952) Crossref, PubMed, ISI, Google Scholar - 74
López E . 2011 A new species of Laonice (Spionidae, Polychaeta, Annelida) from Bellingshausen Sea (West Antarctica). Helgol. Mar. Res. 65, 257–261. (doi:10.1007/s10152-011-0248-1) Crossref, ISI, Google Scholar - 75
DeSalle R, Egan MG, Siddall M . 2005 The unholy trinity: taxonomy, species delimitation and DNA barcoding. Phil. Trans. R. Soc. Lond. B 360, 1905–1916. (doi:10.1098/rstb.2005.1722) Link, ISI, Google Scholar - 76
Wilson NG, Schrödl M, Halanych KM . 2009 Ocean barriers and glaciation: evidence for explosive radiation of mitochondrial lineages in the Antarctic sea slug Doris kerguelenensis (Mollusca, Nudibranchia). Mol. Ecol. 18, 965–984. (doi:10.1111/j.1365-294X.2008.04071.x) Crossref, PubMed, ISI, Google Scholar - 77
Ruta C, Nygren A, Rousset V, Sundberg P, Tillier A, Wiklund H, Pleijel F . 2007 Phylogeny of Hesionidae (Aciculata, Polychaeta), assessed from morphology, 18S rDNA, 28S rDNA, 16S rDNA and COI. Zool. Scr. 36, 99–107. (doi:10.1111/j.1463-6409.2006.00255.x) Crossref, ISI, Google Scholar - 78
Ravara A, Wiklund H, Cunha MR, Pleijel F . 2010 Phylogenetic relationships within Nephtyidae (Polychaeta, Annelida). Zool. Scr. 39, 394–405. (doi:10.1111/j.1463-6409.2010.00424.x) Crossref, ISI, Google Scholar - 79
Schüller M, Ebbe B . 2014 Polychaetes. In Biogeographic atlas of the Southern Ocean (edsDe Broyer C, Koubbi P, Griffiths HJ, Raymond B, d'Udekem d'Acoz C, Van de Putte AP ) , pp. 134–137. Cambridge, UK: Scientific Committee on Antarctic Research. Google Scholar