UDC 575. https://doi.org/10.2298/GENSR2203295A Original scientific article GENETIC DIVERSITY STUDY OF Chrysoperla carnea (Neuroptera: Chrysopidae) POPULATIONS VIA MOLECULAR MARKERS Fatemeh ABDOLAHADI1, Alinaghi MIRMOAYEDI1*, Lila ZARAEI2, Samad JAMALI1 1 Department of Plant Protection, Faculty of Agriculture, Campus of Agriculture and natural Resources, Razi university, Kermanshah, Iran 2 Department of Plant Breeding and Biotechnology, Faculty of Agriculture, Campus of Agriculture and natural Resources, Razi university, Kermanshah, Iran Abdolahadi F., A. Mirmoayedi, L. Zaraei, Samad J. (2022). Genetic diversity study of Chrysoperla carnea (Neuroptera: Chrysopidae) populations via molecular markers.Genetika, Vol 54, No.3, 1295 - 1312. The objective of this study was to determine the genetic diversity among Chrysoperla carnea samples collected from different locations of Iran (including, East-Azerbaijan, West-Azerbaijan, Isfahan, Kerman, Kermanshah, Lorestan, Mazandaran, Gilan, Hormozgan and Hamedan provinces) using the Inter simple sequence repeat (ISSR) and mitochondrial (Cytochrome Oxidase I – COI) molecular markers in 2016-2018. The results showed that a total of 64 bands were produced by ten primers of ISSR markers which among them 43 bands were polymorphic. The highest and lowest polymorphic percentages belonged to primer UBC-809 (88.88%) and primer UBC-886 (33.33%), respectively. The results of cluster analysis based on ISSR marker data divided the samples into three separate clusters. This grouping was also confirmed by analysis of molecular variance. According to the results of the analysis of molecular variance diversity within and among groups was about 84% and 16%, respectively. In the present study five haplotypes were obtained. The first haplotype (H1) was common in all populations which can be considered as the ancestral haplotype, the other haplotypes have been evolved from it. The novelty of this study is that we report the first time genetic diversity analysis of family Chrysopidae using ISSR and CO1 markers covering more than ten provinces and thirty cities of Iran with a full picture of its genetic diversity. Genetic distance matrix based on Jaccard index indicated low genetic distance of ___________________________ Corresponding author: Alinaghi Mirmoayedi, Department of Plant Protection, Faculty of Agriculture, Campus of Agriculture and natural Resources,Razi university, Kermanshah, Iran. Email: alimirmoayedi@gmail.com.phone:+98-09181317087 1296 GENETIKA, Vol. 54, No3, 1295-1312, 2022 populations. The results showed that ISSR and CO1 markers have high efficiency in study of genetic diversity in the family Chrysopidae. Key words: Chrysopidae, Genetic diversity, Iran, ISSR, CO1 Marker INTRODUCTION The family Chrysopidae is composed of approximately 1200 species in 80 genera (MCEWEN et al., 2001). Forty-five species of family Chrysopidae have been recorded in Iran until 2002 (MIRMOAYEDI, 2002 a). These predators are important agents for insect biocontrol due to their host domain, geographical dispersion, resistance against some pesticides and their potential to be produced in mass (MIRMOAYEDI.,2002b).There were also many molecular systematics studies of Chrysopidae in Iran between them MIRMOAYEDI et.al 2012,2017 ; YARI et.al,2017 and HENRY et.al, 2018.During the past century human activities had a negative impact on dispersion, abundance and population size of many species of Chrysopidae. Extinction of species, artificial reproduction or the transfer of species in other places has become a big problem for biocontrol agents and also there was little knowledge of how these events could affect the dispersion of individuals and the genetic diversity of populations (WINTERTON and DE FREITAS, 2006). Human activities and artificial mass production have changed the structure of population genetic which has led to genetic homogenization of populations. Therefore its of utmost importance to have information on the natural composition and genetic structure of the green lacewings populations in a variety of ecosystems (COSTA et al., 2010). Populations are a diverse set of genes. Reduced genetic distance, adverse climatic conditions and habitat loss can led to a decrease in the effective size of populations. Reducing genetic diversity can increase the risk of species extinction. Population-genetic studies are extremely important because the genetic variability of a species is directly associated with its ability to withstand different conditions when introduced into new environments (BARBOSA et al., 2014; HUFBAUER and RODERICK, 2005). Chrysoperla carnea as a predator is widely used in commercial biological control programs. It is also of great economic importance in biological control of pests. So, it is very important to use necessary conservation programs to manage its natural populations. Previous studies have used morphometric traits to evaluate the genetic structure of Chrysoperla carnea. By the development of biological sciences and especially molecular markers, these markers have been used to identify their genetic structure. ISSR marker is a suitable tool in genetic diversity studies. A large number of microsatellite markers have been used to detect genetic polymorphisms among races (BARBOSA et al.,2014 ).Mitochondrial DNA (mtDNA) has many advantages for species identification and mapping of a phylogenetic relationship such as greater number of copies per cell, smaller size, maternal heritability, lack of recombination and lack of conserved regions (BRUFORD et al.,2003). Today molecular methods such as mitochondrial genome sequencing are among the most applicable methods to determine the phylogenetic relationship between populations and closely related species. The mitochondrial cytochrome oxidase (COI) gene has been used in several insect population studies on genetic diversity, population structure, phylogeny, phylogeography and identification of different insect species ( ASOKAN et al., 2007). Expanding management plans and genetic resource modification is useful when the genetic diversity of the populations is clear. This information is necessary for the selection of gene donor populations in artificial reproduction, for the structure of the population and restoration of 1297 F. ABDOLAHADI et al.: GENETIC DIVERSITY STUDY OF Chrysoperla carnea resources (HELMI et al., 2011; HOOPER et al.,1993) comparison between Iranian populations of family Chrysopidae using DNA molecular markers was not studied so far therefore the objective of this study was to investigate the genetic diversity and populations structure of green lacewing Chrysoperla carnea from different regions of Iran using ISSR molecular markers and the mitochondrial COI gene. MATERIALS AND METHODS Sampling: The samples were collected from different regions of Iran including East-Azerbaijan, West-Azerbaijan, Isfahan, Kerman, Kermanshah, Lorestan, Mazandaran, Gilan, Hormozgan and Hamedan provinces from May to November 2016 (Table 1). Sampling was made by sweeping alfalfa plantations by a sweep net and collecting of samples was done by pendulum swings of the net throughout the day and by using of light trapping at the night. In this experiment, 2000 samples were collected from 10 provinces and 30 samples from each province (300 samples in total) were selected for molecular studies. The collected samples with light trapping were kept in 70% ethanol and some of them were kept dry in double-layered cotton pads. Table 1. Sampling localities and geographical positions in this research Province Western Azerbaijan Lorestan Isfahan Gilan City latitude Longitude Height Code Urumiva 37.55321585 45.07627659 1348 1 Bukan 36.51512233 46.20708472 1340 2 Khoy 38.55179431 44.95974594 1136 3 Khorramabad 33.48868134 48.35929003 1188 4 Borujerd 33.89813714 48.7501026 1572 5 Kuhdasht 33.52941544 47.60903406 1192 6 Isfahan 32.67210698 51.67157274 1575 7 Khansar 33.22605745 50.31752524 2215 8 Shahreza 32.00734554 51.85222690 1833 9 Rudbar 36.82289358 49.42928867 212 10 Rasht 37.28079786 49.59250067 +3 11 Astara 38.42208367 48.86927386 -24 12 1298 Mazandaran Kermanshah Hamedan East Azerbaijan Kerman Hormozgan GENETIKA, Vol. 54, No3, 1295-1312, 2022 Sary 36.56611747 53.05876297 42 13 Amol 36.46981559 52.35124183 94 14 Chaloos 36.65428442 51.42130387 29 15 Kermanshah 34.32365879 47.07410791 1351 16 Kangavar 34.50332392 47.96530129 1468 17 Sarpol-zahab 34.45758373 45.86860067 556 18 Hamedan 34.79881288 48.51516762 1818 19 Malayer 34.29290641 48.82193253 1748 20 Kabudarahang 35.20000154 48.71226525 1672 21 Maragheh 37.38950217 46.23764728 1451 22 Tabriz 38.07847882 46.30374328 1402 23 Marand 38.43060508 45.77383802 1331 24 Kerman 30.28451186 57.07261258 1764 25 Baft 29.23494228 56.59894493 2275 26 Kuhbanan 31.41029769 56.28292425 1990 27 Minab 27.14554001 57.07321481 40 28 BandarAbbas 27.19463488 56.30798292 17 29 Rudan 27.44130894 57.19104800 196 30 DNA extraction Total genomic DNA was extracted from the head and thorax sections of each Chrysoperla carnea sample using the salting out method with slight modifications and then stored at −20 ºC (AWASTHI et al.,2004). F. ABDOLAHADI et al.: GENETIC DIVERSITY STUDY OF Chrysoperla carnea 1299 PCR amplification (ISSR markers) DNA samples were amplified using 10 ISSR primers (Table 2). Polymerase chain reaction (PCR) reactions were performed in 25μL volumes containing 60 ng template DNA, 400 μM of each dNTPs, 1X PCR buffer (100 mM Tris-HCl, 50 mM KCL, 0.01% gelatin, and 0.25% tween 20), 1 μM of each primer pair, 1 units/μl Taq DNA polymerase, and MgCI2 (0.9–1.5 mM) described by (AWASTHI et al.,2004) with minor modifications. Amplification was performed in a thermocycler in the following manner; one denaturation step at 94 ºC for 5 min, followed by 35 cycles of denaturation at 94 °C for 48 s, annealing at 55° C (depending on the primer) for 60 s, extension at 72 °C for 110 s, and a final extension at 72 °C for 10 min. Thermocycler was run to work following the program described above and at the end the PCR product was obtained and was poured on an 2% agarose gel in a 1X TBE buffer and electrophoresed for about one hour at 80 Watts and afterward the gel stained with Ethidium Bromide. Table 2. ISSR -marker primers used by us in the study (BARBOSA et al.,2014) Primer Sequence (5’ → 3’) Annealing temperature (ºC) UBC-809 UBC-820 5´-GAGAGAGAGAGAGAGG-3´ 5´-GTGTGTGTGTGTGTGTC-3´ 51 55 UBC-836 UBC-849 UBC-856 5´-AGAGAGAGAGAGAGAGCA-3´ 5´-GTGTGTGTGTGTGTGTCA-3´ 5´-ACACACACACACACACTA-3´ 48 55 55 UBC-880 UBC-886 UBC-891 5´-GGAGAGGAGAGGAGA-3´ 5´-CTCCTCCTCCTCCTCGT-3´ 5´-GAGCTCTCTCTCTCTCT-3´ 88 46 50 UBC-810 UBC-812 5´-GAGAGAGAGAGAGAGAT-3´ 5´-GAGAGAGAGAGAGAGAA-3´ 48 51 Data analysis The banding pattern of ISSR markers were scored based on the presence or absence of a band in samples. The POPGENE software version 1.31 was used for estimating population genetic structure. The NTSYS-pc version 2.02 was used to cluster analysis, and GenAlex software was used for the analysis of molecular variance (AMOVA) ( ROYCHOUDHURY and NEI, 1988). PCR amplification (mtDNA (CO1)) Generic primers were used to amplify genomic DNA. Two sets of primers were used for amplifying COI gene region. . These were C1-J-2183 (5’CAACATTTATTTTGATTTTTTG G3’) and TL2-N-3014 (5’TCCATTGCACTAATCTGCCATATTA3’) (BIOEDIT,2019;AVISE et al.,1989), PCR was run in a total volume 25 µl of the following reaction mixture: 2.5 µl of 10× reaction buffer with KCl as provided by the manufacturer (Fermentas Life Sciences, Vilnius, Lithuania), 1 mM MgCl2, 0.5 mM of dNTP mix, 1 µM of each primer, 2 U of Taq polymerase 1300 GENETIKA, Vol. 54, No3, 1295-1312, 2022 and 50 ng of total purified honey bee DNA. For each primer pair, the following reaction profile was used: initial denaturation 94ºC for 4 min, 35 cycles of 94ºC for 30 s, annealing at 55ºC for 1 min, and extension at 72ºC for 1 min, followed by a final extension step at 72ºC for 10 min. PCR products were sent to south Korea and sequenced there using method of GeneAll Combo Kit, South Korea (TAMURA et al.,2013) by double stranded assay (ABI3730xl, USA, Macrogen Corporation). Data analysis 498-bp sequences of part of the mitochondrial genome cytochrome oxidase region of 60 samples from 30 populations of Chrysoperla carnea were first visualized by (BioEdit version 7.0.5.3,2019) and sequencing was performed using Clustal X (THOMPSON et al.,1997).The sequences were blasted in the gene bank at NCBI site to compare and confirm species identification. Descriptive analyses were performed using DnaSP software version 5.10.01 (LIBRADO and ROZAS, 2009) and the number of polymorphic sites (S), number of haplotypes (h), haplotype diversity (Hd), nucleotide diversity (π), fixation index (FST) and the number of migrants (Nm) were obtained. The nucleotide substitution rate, frequency of each and the genetic distance between populations were determined by software MEGA version (TAMURA et al., 2013) using Kimura 2- parameter method and gamma evolutionary model. The relationship between genetic distance Fst and geographic distance km was studied by Mantel test ( MANTEL, 1967). The phylogenetic tree was obtained from Maximum likelihood and Bootstrap using MEGA (Fig 3.). RESULTS ISSR Three hundred Chrysoperla carnea genotypes were used as materials for DNA genotyping. All used primers showed polymorphism in amplified loci (Table 3). The allele size range varied from 150 to 1500 (bp). All primers showed polymorphisms among all populations. The total number of bands were 64, of which 43 bands were polymorphic. The number of bands scored for each primer varied from 5 to 9. Primer UBC-809 with eight bands and primer of UBC-886 with two bands showed the maximum and the minimum numbers of polymorphic bands among the used primers respectively. The polymorphism percentage for each primer varied from 33.33% to 88.88% (Table 3). The highest and lowest PIC values belonged to primers UBC-809 and UBC-812 (0.643and 0.302), respectively. The genetic diversity index (Nei’s index=He) and Shannon’s index (I) were calculated for each of the primers using the results of the ISSR data. The primers UBC-809 and UBC-812 had the highest and the lowest Shannon index respectively (Table 3). Maximum heterozygosity value of an ISSR locus was 0.282. Finally, the average heterozygosity values for all detected loci for each primer were estimated. The average heterozygosity was 0.190, and the range was between 0.149 and 0.282. In the current study the genetic distance among populations was calculated based on Jaccard’s similarity coefficient (Table 4). The lowest genetic distance was found among populations of West and East Azerbaijan provinces (0.0412). The low values of the genetic distance among the studied populations indicated a large similarity among the samples of the studied provinces. 1301 F. ABDOLAHADI et al.: GENETIC DIVERSITY STUDY OF Chrysoperla carnea Table 3. Polymorphism in different populations of Chrysoperla carnea by use of 10 ISSR primers. Shannon's diversity (I) Heterozygosity Polymorphism percentage Polymorphic (PIC) number of polymorphic bands total number of bands size range of observed alleles name of primers UBC-809 150-1400 9 8 0.643 88.88 0.282 0.459 UBC-820 220-1500 8 6 0.615 75 0.231 0.380 UBC-836 280-1200 7 5 0.572 71.42 0.201 0.342 UBC-849 300-1500 6 4 0.464 66.66 0.176 0.307 UBC-856 180-1500 6 4 0.444 66.66 0.164 0.298 UBC-880 170-1400 7 4 0.521 57.14 0.198 0.331 UBC-886 300-750 6 2 0.391 33.33 0.183 0.261 UBC-891 250-1100 5 4 0.320 80 0.167 0.223 UBC-810 300-700 5 3 0.311 60 0.152 0.209 UBC-812 210-1000 5 3 0.302 60 0.149 0.194 Genetic distances of studied populations Table 4. Genetic distances based on Jaccard’s coefficient among C. carnea populations 1 2 3 4 5 6 7 8 9 E.Azerbaijan(1) W.Azerbaijan(2) 0.0412 Hamedan(3) 0.1310 0.1510 Kermanshah(4) 0.1241 0.1311 0.0861 Lorestan(5) 0.1441 0.1311 0.0951 0.0861 Gilan(6) 0.1698 0.1510 0.1176 0.1070 0.0921 Mazandaran(7) 0.1587 0.1421 0.1354 0.1065 0.0941 0.0821 Esfahan(8) 0.0994 0.0912 0.0840 0.0810 0.0791 0.0823 0.0723 Hormozgan(9) 0.0891 0.0821 0.0721 0.0710 0.0671 0.0569 0.0721 0.0998 Kerman(10) 0.0852 0.0901 0.0730 0.0921 0.0652 0.0532 0.0891 0.0787 0.0541 1302 GENETIKA, Vol. 54, No3, 1295-1312, 2022 Cluster analysis Cluster analysis based on unweighted pair group method (UPGMA) using Jaccard similarity coefficient divided the studied populations into three different groups (Figure 1.). The cophenetic correlation coefficient was 0.9 indicating of the goodness-of fit of the dendrogram to the original data. Dendrogram showed that the northern provinces of Iran are scattered in the first group and the southern and central provinces in the third group. The grouping largely corresponded to the geographical origin. Figure 1. Cluster analysis based on UPGMA using Jaccard similarity coefficient in the studied populations.The numbers 1-30 in the vertical axis of dendrogram corresponds to the cities in Table 1. Two-dimensional scatter plot of studied samples based on principal component analysis using the Jaccard coefficient are presented in Figure 2. Chrysoperla carnea samples were divided into three main groups, confirmed the results of the cluster analysis. 1303 F. ABDOLAHADI et al.: GENETIC DIVERSITY STUDY OF Chrysoperla carnea Figure 2. Two-dimensional diagram, the resultant of two components analysis, this graph was drawn, by considering the first and the second components AMOVA analysis The results of the analysis of molecular variance (AMOVA) based on ISSR marker data is shown in the table 5. Therfore, according to molecular analysis of variance (AMOVA), intra-population and inter-population genetic diversity were estimated to be 84% and 16%, respectively. Table 5. Result of AMOVA based on data produced by use of ISSR marker Source Df MS Variance of each component Total percentage variance PHIPT P-value Among populations 2 241.540* 1.680 %16 0.019 0.002 11.038 12.005 %84 252.578 13.685 %100 Within populations Total 297 299 CO1 DNA sequences at NCBI site were blast in order to compare and confirm species identification, and high similarity was observed (92-100%) with reported populations from other parts of the world. The average nucleotide composition of 498 bp of COI sequences of thymine, cytosine, adenine and guanine bases were 40.6%, 15.3%, 29.4% and 14.7%, respectively. Five haplotypes were obtained from all populations studied. Among them, Haplotype 1 (H1) was 1304 GENETIKA, Vol. 54, No3, 1295-1312, 2022 observed in all populations. Haplotype 2 (H2) was common among all populations except Bandar Abbas, Kerman and Isfahan. Haplotype 3 (H3), Haplotype 4 (H4) and Haplotype 5 (H5) were observed in a populations (Lorestan, Sari and Rasht, respectively) with the highest number of nucleotide differences in the north group (Table 7). Table 6.Distribution of haplotypes of different populations of C. carnea in Iran Populations Haplotype H1 H2 2 3 4 5 6 7 8 9 10 3 3 3 1 1 1 2 2 2 2 20 1 1 1 1 1 1 1 7 H3 H4 Total 1 1 1 1 1 H5 1 1 Total 30 Table 7. Genetic diversity indices of the mitochondrial gene of COI for each population N Tabriz(1) Urumiva(2) Hamedan(3) Kermanshah(4) Khorramabad(5) Rasht(6) Sari(7) Esfahan(8) Bandar- Abbas(9) Kerman(10) Total 3 3 3 3 3 3 3 3 3 3 30 S h Hd k 1 1 1 1 2 2 2 0 0 0 10 2 2 2 2 3 3 3 1 1 1 20 0.653 0.653 0.653 0.653 1 1 1 0.000 0.000 0.000 0.653 0.653 0.653 0.653 1.343 1.343 1.343 0.000 0.000 0.000 pi 0.0010 0.0010 0.0010 0.0010 0.0020 0.0020 0.0020 0.0000 0.0000 0.0000 It seems that Haplotype 1 (H1) which is the largest and includes all the studied populations, is considered as the oldest or native haplotype. The less frequent haplotypes include the smaller population are smaller in size and depending on the number of mutations, they bind more closely to the central haplotype. Studies on phylogenetic relationships showed that most populations are very close together and 5 haplotypes obtained are also differentiated on the phylogenetic tree. Analysis of molecular variance (AMOVA) showed that genetic changes within populations was a general occurence. The Mantel test indicated no correlation between genetic and geographic distances (r = 0.0950; P = .198). The genetic distance between populations was very low and varied from 0.001 to 0.005. The genetic distance between populations was low for both markers. 1305 F. ABDOLAHADI et al.: GENETIC DIVERSITY STUDY OF Chrysoperla carnea Table 8 .Nei’s genetic distance based on mtDNA (COI) (below diagonal) and geographic distance (km) (above diagonal) of C. carnea populations 1 Tabriz(1) 2 3 4 5 6 7 8 146 552 580 797 475 869 891 531 542 721 614 1008 1030 188 246 400 568 508 189 578 747 619 645 726 377 362 634 Urumiova(2) 0.001 Hamedan(3) 0.004 0.004 Kermanshah(4) 0.003 0.004 0.001 Khorramabad(5) 0.005 0.004 0.002 0.003 Rasht(6) 0.005 0.003 0.004 0.003 0.003 Sari(7) 0.005 0.005 0.004 0.004 0.002 0.002 Esfahan(8) 0.004 0.002 0.003 0.002 0.002 0.003 0.003 Bandar- abas(9) 0.003 0.001 0.002 0.003 0.002 0.003 0.003 0.001 Kerman(10) 0.002 0.002 0.001 0.002 0.001 0.002 0.001 0.003 690 9 10 1801 1503 1940 1642 1418 1120 1596 1299 1344 1046 1544 1246 1525 1227 968 671 486 0.003 Low genetic distances were also observed by BARBOSA et al, 2014, between populations of Chrysoperla externa in the São Paulo State in Brazil. The gene flow and the neutrality test Tajima's values was obtained for all studied populations and are successively Nm= 22, Gst= 0.0128 and D= -1.7321. The overall stability index FST was not significant for all populations. FST = -0.09831; p> 0.05), which indicated the absence of genetic structure between these populations. The prominent features of mitochondrial genes especially CO1 such as lack of introns, low number of deletion sites and high rate of evolution (10-1 rate - single copy nuclear gene) makes it a suitable marker not only for differentiation near species but also for phylogeographic studies of species (AVISE et al., 1987; BROWER, 1994). The rapid sequencing divergence rate, especially at silent sites of mitochondrial protein coding genes, allows for recently branched lines to be separated (HARRISON, 1989). In the present study we used CO1 gene in order to evaluate the genetic structure and diversity of geographical populations of Chrysoperla carnea in Iran. The study of genetic diversity parameters indicated that there is little haplotype and genetic diversity between the populations studied. 5 haplotypes were obtained from COI gene sequence analysis. Analysis of molecular variance (AMOVA) showed that genetic variation within populations was greater than genetic change between populations. The results showed that the high gene flow and low genetic diversity between populations may help to attract different populations.The negative value obtained from neutrality test (Tajima's D = 1.732) indicated the population integration and low frequency of polymorphism. The phylogenetic tree clustered 30 samples in a clade (Fig 3). This phylogenetic tree confirms high 1306 GENETIKA, Vol. 54, No3, 1295-1312, 2022 genetic diversity among individuals, although there was not a clear genetic structural change in the population. Ceraeochrysa lineaticornis (NCBI accession KR146303) was selected as the outgroup and the confidence level was calculated with the 1000 replicates of the bootstrap test. The results showed that the high gene flow and low genetic diversity between populations could not have a great impact on the change of genetic structure of different populations of lacewings studied by us. In numerous studies, COI sequences have been used to examine the population structure of a species and populations have been subdivided into clades or groups. The study of Chrysoperla externa (Neuroptera: Chrysopidae) populations in Brazil and Pectinophora gossypiella (Lepidoptera: Gelechiidae) in India (HUNDSDOERFER and WINK,2009) which showed no specific genetic diversity between the studied populations, however these authors blamed migrations and displacing of insects in long distances as two major factors responsible for the change of genetic structure of the studied insect populations. Nucleotides accession numbers was obtained from NCBI by direct submission to NCBI gene bank data base for genes of CO1 in our study and totally 30 accession numbers were obtained as follows; Eight accession numbers MW857150 to MW857157, Eleven accession numbers MW909771 to MW909781, nine accession numbers from MZ376743 to MZ376751, two accession numbers MW856823 and MZ37675. 3 Figure 3. Phylogenetic tree with Maximum likelihood method based on sequences of Chrysoperla carnea populations in Iran F. ABDOLAHADI et al.: GENETIC DIVERSITY STUDY OF Chrysoperla carnea 1307 DISCUSSION The genetic differentiation in insects may be due to differences in genetic traits such as gene flow, changes in environmental conditions, natural selection and random processes such as mutations, migration and the level of population differentiation.When one or more of these forces are acting in a population, the population violates the Hardy-Weinberg assumptions and evolution occurs (ANDREWS,2010). The genetic differentiation may be due to differences in genetic traits because of changes in environmental conditions and natural selection as well as random processes such as mutations, migrations and the differentiation level of populations which could be estimated by different parameters (NEI, 1972). Gene flow could be considered as one of the responsible cause of the change in genetic structure of the population. Steffler and coworkers used ISSR and GenAlex and considering different climatic types (humid tropical, agreste and semiarid) and have sampled Aedes aegypti vectors of yellow fever and Zika in Sergipe,Brazil significant genetic variability but little differentiation was observed among Ae. aegypti populations, possibly reflecting intense gene flow mediated by the passive dispersion of mosquitoes due to the intense traffic of vehicles among the cities ( STEFLER et al., 2016). Rosas and co-workers, studied Triatoma infestans the vector of chagas disease in Brazil and expressed that there was not a significant association between geographical distance and genetic differentiation (ΦST) among sites (Mantel r = 0.09, P = 0.31) indicating a restricted gene flow among sampling sites where allele frequencies could drift independently from geographical distances separating them (DE ROSAS et al.,2017). Chen and co-workers considered differing environments as an impact factor and used ISSR , Cluster analyses and UPGMA to study genetic changes in Chinese populations of gypsy moth(Lymantria dispar), they have seen stronger genetic relationships among geographically proximate locations and concluded that more closely related populations share a common origin or evolutionary history and observed a high overall genetic differentiation among populations (AMOVA: FST = 0.2543, P < 0.001) which has given further support to the finding of strong genetic structuring among the Chinese gypsy moth (CHEN et al.,2014).De Rosas and co-authors studied Triatoma infestans the vector of chagas disease in Brazil and expressed that there was not a significant association between geographical distance and genetic differentiation (ΦST) among sites (Mantel r = 0.09, P = 0.31) indicating a restricted gene flow among sampling sites where allele frequencies could drift independently from geographical distances separating them ( DE ROSAS et al.,2017). Hu and coauthors have used ISSR marker for identification of house flies (Musca domestica) populations from different cities and regions in China and found differences in genetic diversity , genome and gene types of geographic populations of M. domestica from different cities and regions of China (HU et al.,2008). Hundsdoerfer and Wink studied separated pairs of the moths Hyles euphorbiae and their offsprings in Spain, used ISSR-PCR with 4 primers and found that the bands sharing index did not detect significant difference of genetic variability compared between siblings and individuals of Hyles euphorbiae collected from different localities at random (HUNSDOERFER and WINK, 2005). Rahimi and coworkers by using of ISSR and UPGMA have studied the genetic polymorphism between honeybee population in Iran, the authors showed that genetic similarity existed between honey bee populations of six different provinces of Iran, the possible factors were migration of bees to neighboring provinces. Cluster analysis showed that two neighboring provinces of East and West Azerbaijan formed a single group differentiated 1308 GENETIKA, Vol. 54, No3, 1295-1312, 2022 from the other groups, the existing trade of queens as well as colonies of bees between beekeepers of these two provinces was considered as the factors responsible of genetic similarities between honey bee populations of these two neighbor provinces ( RAHIMI et al.,2016).The improvement of genetic studies of Chrysoperla carnea as a model of green lacewing and its use in breeding programs is directly dependent on the preserving of genetic diversity among their populations. Our study besides the studies of many other authors proved that ISSR markers have a large potential in revealing the existing polymorphism in insects in general (HELMI et al., 2011; HU et al., 2010; DE ROSAS et al., 2017; ABBOT, 2001; HU et al.,2007) and specifically in study of polymorphism in green lacewings, Chrysoperla spp. populations in particular (BARBOSA et al.,2014). Helmi and co-authors have used primers UBC-812 and UBC819 in Hemiptera order (HELMI et al., 2011), they have obtained similar results to us. In our study primer UBC-809 with nine alleles (in all populations) had the highest number of observed alleles in studied populations and primer UBC-880 had the highest values for PIC, He and I indices. High levels of genetic diversity were observed for both markers. The results showed that the highest values of genetic diversity appear associated with cities that have the greatest areas of native vegetations. The results of grouping geographical populations showed that the southern and central regions of the country have less haplotypic diversity than the northern regions. By using Mantel’s test we have found no relationship between genetic and geographical distances. Such a formation of genetic structure could be the result of the establishing of an uniform farming in ecosystem and the transfer of insects by humans which has led to high gene flow and reduced genetic differences even at long geographical distances. Our study revealed that the samples collected from Gilan, Mazandaran, and Lorestan provinces had a higher number of alleles and genetic diversity indices than samples collected from other locations in Iran. The improvement of genetic status of Chrysoperla carnea as a model of green lacewing and its use in breeding programs depends on the preserving of genetic diversity amongst their populations. The current results showed that ISSR markers as a technique has a large potential in study of polymorphism in Chrysoperla carnea populations. Some of the studied ISSR primers including UBC-809, UBC-812 and UBC819 in the Hemiptera order have been used previously and show similar results to what obtained by us (ABBOT.,2001). In our study, primer UBC-809 with nine alleles (in all populations) had the highest number of observed alleles in studied populations and primer UBC-880 also had the highest values for PIC, He and I indices. High levels of genetic diversity were observed for both markers. The results showed that the highest values of genetic diversity appear associated with cities that have the greatest areas of native vegetations. The results of grouping geographical populations showed that the southern and central regions of the country have less haplotypic diversity than the northern regions. In Mantel test, no relationship was found between genetic and geographical distances. Such a genetic structure can be the result of the establishment of a uniform farming ecosystem and the transfer of insects by humans leading to high gene flow and reduced genetic difference even at long geographical distances. Our study revealed that the samples collected from Gilan, Mazandaran, and Lorestan provinces have a higher number of alleles and genetic diversity indices. High vegetation cover is one of the main reasons for increasing genetic diversity in these areas. The results of this study are similar to those by other authors on Chrysoperla externa (BARBOSA et al., 2014). A low genetic distance was observed among the studied populations indicating a high genetic similarity between the F. ABDOLAHADI et al.: GENETIC DIVERSITY STUDY OF Chrysoperla carnea 1309 studied provinces. In the same study, Barbosa and coauthors examined the genetic polymorphism of Chrysoperla externa populations in Brazil using the ISSR marker and they reported a low genetic distances among studied populations. The genetic differentiation may be due to differences in genetic traits, changes in environmental conditions and natural selection. Random processes such as mutations, migration, and the level of population differentiation also contribute to such differences. Finally Results obtained in our study showed us that ISSR- PCR technique has a reliable capacity to identify polymerphism in the studied populations of Chrysoperla carnea, the same results was obtained by different authors using ISSR for study of species of insects belonging to different orders ( KURD et al., 2020; CHEN et al., 2014; LIU et al., 2010; SUN et al.,2016). Given the positive relationship between the amount of genetic variations and the amount of evolutionary change occurring, there is a similar relationship between the gene improvement efficiency of a breeding population and genetic diversity for the trait in question. Therefore conservation of genetic resources is essential. Understanding genetic diversity in insects could help us to understand the genetic structure, population adaptability as well as succees in finding food for them. ACKNOWLEDGEMENTS The authors appreciate the kindness of the president of the park of Science and technology of Hamedan who let us free access to use facilities in the laboratories there which led to fulfilment of the present study. We thank equally the anonymous and unknown reviewers for reading and making useful comments to improve the quality of our manuscript. Received, August 10th, 2021 Accepted July 28th, 2022 REFERENCES (2001): Individual and population variation in invertebrates revealed by Inter-simple Sequence Repeats (ISSRs). Insect Sci., 1(1):8-21. ANDREWS, C. A (2010): Natural Selection, Genetic Drift, and Gene Flow Do Not Act in Isolation in Natural Populations. Nature Education Knowledge 3(10):5, Available at https://www.nature.com/scitable/knowledge/library/natural-selection-genetic-drift-and-gene-flow15186648/#(visited 15.December2020) ASOKAN, R., NK., KUMAR, V., KUMAR, H., RANGANATH (2007): Molecular differences in the mitochondrial cytochrome oxidase I (mtCOI) gene and development of a species-specific marker for onion thrips, Thrips tabaci Lindeman and melon thrips, T. palmi Karny (Thysanoptera: Thripidae), vectors of tospoviruses (Bunyaviridae). Bull. Entomol. Res., 97(5):461-470. AVISE, J.C.,J.,ARNOLD, R.M.,BALL,E.,BIRMINGHAM, T.,LAMB,J.E.,NEIGEL, C.A., REEB, N.C., SAUNDERS (1987): Intraspecific phylogeography, the mitochondrial DNA bridge between population genetics and systematics. Annu. Rev. Ecol. Syst., 18:489-522. AWASTHI, AK., G., NAGARAJA, G.,NAIK, S.,KANGINAKUDRU, K.,THANGAVELU, J., NAGARAJU (2004): Genetic diversity and relationships in mulberry (genus Morus) as revealed by RAPD and ISSR marker assays. BMC genetics, (1):156165. ABBOT, P. 1310 GENETIKA, Vol. 54, No3, 1295-1312, 2022 BARBOSA NARA, C.C.P., S.D.,FREITAS, A.C., MORALES (2014): Distinct genetic structure in populations of Chrysoperla externa (Hagen)(Neuroptera, Chrysopidae) shown by genetic markers ISSR and COI gene. Rev. Bras. Entomol., 58(2): 203-211. BIOEDIT: 7.0.5.3, released Jan 28, 2019,bioedit.zip, a user-friendly biological sequence alignment editor and analysis program for Windows. https://bioedit.software.informer.com/ BROWER, A. (1989): Rapid morphological radiation and convergence among races of the butterfly Heliconius erato inferred from patterns of mitochondrial DNA evolution. Proc.Natl.Acad.Sci., 91(14):6491-6495. BRUFORD, M.W., D.G., BRADLEY, G.,LUIKART (2003): DNA markers reveal the complexity of livestock domestication. Nat. Rev. Genet., 4(11):436-450. CHEN, F., J.SHI, Y-Q. LUO, S-Y. SUN, M.PU (2013): Correction: Genetic Characterization of the Gypsy Moth from China (Lepidoptera, Lymantriidae) Using Inter Simple Sequence Repeats Markers. https://pubmed.ncbi.nlm.nih.gov/23951339/ CHEN,F.,T.AHMED,Y.JUANLIU,K.LAIHE, Z.YINGWANG (2014): Analysis of genetic diversity among different geographic populations of Athetis lepigone using ISSR molecular markers. J. Asia.Pac. Entomol.,17(4):793-798. COSTA, R.I., B.,SOUZA, S.D., FREITAS (2010): Dinâmica espaço-temporal de taxocenoses de crisopídeos (Neuroptera: Chrysopidae) em ecossistemas naturais. Neotrop. Entomol., 39(4):470-475. DE ROSAS, A.R.P., M.F., RESTELLI, C.J., FERNÁNDEZ, M.J.,BLARIZA, B.A.,GARCÍA ( 2017): Application of inter-simple sequence repeat markers in the analysis of populations of the Chagas disease vector Triatoma infestans (Hemiptera, Reduviidae). Am. J. Trop. Med. Hyg., 96(3):660-3. HARRISON, R.G (1989): Animal mitochondrial DNA as a genetic marker in population and evolutionary biology. Trends. Ecol. Evol., 4(1):6-11. HELMI, A., A., KHAFAGA, M.,EL-FATIH (2011): Molecular Fingerprinting of certain cereal aphids in Egypt (Hemiptera: Sternorrhyncha: Aphididae) using RAPD and ISSR markers. Mun. ent. Zool., 6(1):363-376. HENRY,C.S., S.J. BROOKS, J.B, JOHNSON, A. MOCHIZUKI, A. MIRMOAYEDI, P. DUELLI, (2018):Distinctive but functionally convergent song phenotypes characterize two new allopatric species of the Chrysoperla carnea-group in Asia,Chrysoperla shahrudensis sp. nov. and Chrysoperla bolti sp. nov. (Neuroptera: Chrysopidae). J. Nat. Hist.,52(25–26):1603–1635. HOPPER, K., R.T., ROUSH, W.,POWELL ( 1993): Management of genetics of biological-control introductions. Annu. Rev. Entomol., 38(1):27-51. HU, J.L., X.L., ZHENG, Q., WANG, X.G., CHEN, Y.P., HUANG (2008): Identification of necrophagous fly species from 12 different cities and regions in China using inter-simple sequence repeat melocular markers]. Nan Fang Yi Ke Da Xue Xue Bao. 2008 Apr;28(4):524-8. Chinese. PMID: 18495581. HUFBAUER, R.A., G.K., RODERICK (2005): Microevolution in biological control: mechanisms, patterns, and processes. Biol. Control., 35(3):227-239. HUNDSDOERFER, A.K., M .,WINK (2009): Experimental population genetics in insects: inheritance of ISSR-PCR bands in an artificial population. Zootaxa., 2231(1):40-6. LIBRADO,P., J., ROZAS (2009): DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Genet. Popul. Anal.,25(11):1451-1452. KURD, Ö., E.,DOĞAÇ2, V.,TAĠKIN, B.,GÖÇMEN TAĠKIN (2020): ISSR marker based population genetic study of mediterranean fruit fly Ceratitis capitata (Diptera: Tephritidae).Genetika 52(1):311-322 LIU, J. NI., F.R., GUI, Z.Y., LI (2010): Genetic diversity of the planthopper, Sogatella furcifera in the Greater Mekong Subregion detected by inter-simple sequence repeats (ISSR) markers. Insect Sci., Volume 10, Issue 1,52, https://doi.org/10.1673/031.010.5201 visited at: 7.1.2020 F. ABDOLAHADI et al.: GENETIC DIVERSITY STUDY OF Chrysoperla carnea MCEWEN, P. K., T. R., NEW, A. E., WHITTINGTON 1311 (2001). Lacewings in the Crop Environment.Cambridge University Press,UK. MANTEL, N. (1967): The detection of disease clustering and a generalized regression approach. Cancer. Res., 27(2):209220. MIRMOAYEDI, A. (2002 a): New records of Neuroptera from Iran. Acta. Zool. Acad.Sci. Hung., 48:197-201. MIRMOAYEDI, A. (2002b): Forty years of studies by Iranian entomologists on the Chrysopidae fauna of Iran (1961– 2000)(Insecta, Neuroptera). Zool. Middle. East., 26(1):157-162. MIRMOAYEDI, A., D. KAHRIZI, A.A. EBADI, K. YARI, M.MOHAMMADI (2012): Study of individual and sex genetic diversity among each genus and between two genera of Chrysopa and Chrysoperla (Neuroptera, Chrysopidae) based on RAPD-PCR polymorphism.Mol Biol Rep 39: 8999–9006. MIRMOAYEDI,A., M. MARAMI, D. KAHRIZI, K.YARI (2017): Comparison of Phylogenetic Relationships Between Populations of Chrysopidae Family (Insecta: Neuroptera) in Tehran and Kermanshah Provinces. Biol. Environ. Agri Sci, 2:49-58 NEI, M.(1972): Genetic distance between populations. Am. Nat., 106(949):283-292. ROYCHOUDHURY, A.K., M.,NEI (1988): Human polymorphic genes, world distribution., Oxford University Press, USA. SINGH, Y.T., MAZUMDAR-LEIGHTON, S.,M., SAIKIA, P.,PANT, S., KASHUNG, K., NEOG, R., CHAKRAVORTY, S., NAIR, J,REGOWDA, N.,RAJU, C.R., BABU (2012):Genetic Variation within Native Populations of Endemic Silkmoth Antheraea assamensis (Helfer) from Northeast India Indicates Need for In Situ Conservation. PLoS One., 7(11): e49972. STEFFLER, L.M., S.S.,DOLABELLA, P.E., RIBOLLA, C.S., DREYER, E.D.,ARAÚJO, R.G.,OLIVEIRA, W.F.S.,MARTINS, R., LACORTE (2016): Genetic variability and spatial distribution in small geographic scale of Aedes aegypti (Diptera: Culicidae) under different climatic conditions in Northeastern Brazil. Parasit Vectors., 9(1):530.1-9 SUN, Y.W.E., W., WANG, K.WANG, H.GE WANG (2016): Effects of habitat fragmentation on genetic diversity and population differentiation of Liposcelis bostrychophila badonnel (Psocoptera: Liposcelididae) as revealed by ISSR markers. J. Stored. Prod. Res., 68: 80-84 TAMURA,K.,G.,STECHER,D.,PETERSON, A., FILIPSKI, S.,KUMAR( 2013): MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol., 30(12):2725-2729. THOMPSON, J.D., T.J., GIBSON, F., PLEWNIAK, F.,JEANMOUGIN, D.G., HIGGINS (1997): The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucl. Acids Res., 25(24):4876-4882. WINTERTON,S.,S.D.FREITAS (2006): Molecular phylogeny of the green lacewings (Neuroptera: Chrysopidae). Aust. J. Entomol., 45(3):235-243. YARI,K., M. MARAMI, A. MIRMOAYEDI, E.KAZEMI (2014): Genetic diversity analysis of chrysopidae family (insecta, neuroptera) via molecular markers . Mol Biol Rep, 41: 6241–6245 1312 GENETIKA, Vol. 54, No3, 1295-1312, 2022 PROUČAVANJE GENETSKOG RAZNOLIKOSTI POPULACIJA Chrisoperla carnea (Neuroptera: Chrisopidae) PREKO MOLEKULARNIH MARKERA Fatemeh ABDOLAHADI1, Alinaghi MIRMOAIEDI1*, Lila ZARAEI2, Samad JAMALI1 1 Odsek za zaštitu bilja, Poljoprivredni fakultet, Kampus poljoprivrede i prirodnih resursa, Razi univerzitet, Kermanšah, Iran 2 Odsek za oplemenjivanje biljaka i biotehnologiju, Poljoprivredni fakultet, Kampus za poljoprivredu i prirodne resurse, Univerzitet Razi, Kermanšah, Iran Izvod Cilj ove studije bio je da se utvrdi genetička raznolikost među uzorcima Chrisoperla carnea prikupljenim sa različitih lokacija Irana (uključujući provincije Istočni Azerbejdžan, Zapadni Azerbejdžan, Isfahan, Kerman, Kermanšah, Lorestan, Mazandaran, Gilan, Hormozgan i Hamedan) koristeći molekularni markeri inter jednostavne sekvence ponavljanja (ISSR) i mitohondrijalnih (citokrom oksidaza I – COI) u 2016-2018. Rezultati su pokazali da je ukupno 64 trake proizvedeno sa deset prajmera ISSR markera od kojih su 43 trake bile polimorfne. Najveći i najmanji postotak polimorfnosti imao je prajmer UBC-809 (88,88%) i prajmer UBC886 (33,33%), respektivno. Rezultati klaster analize na osnovu podataka ISSR markera podelili su uzorke u tri odvojena klastera. Ovo grupisanje je takođe potvrđeno analizom molekularne varijanse. Prema rezultatima analize molekularne varijanse diverzitet unutar i među grupama iznosio je oko 84% i 16%, respektivno. U ovoj studiji dobijeno je pet haplotipova. Prvi haplotip (H1) bio je uobičajen u svim populacijama koje se mogu smatrati haplotipom predaka, ostali haplotipovi su evoluirali iz njega. Novina ove studije je da izveštavamo o prvoj analizi genetičke raznovrsnosti porodice Chrisopidae koristeći ISSR i CO1 markere koji pokrivaju više od deset provincija i trideset gradova Irana sa potpunom slikom njegove genetske raznovrsnosti. Matrica genetičke udaljenosti zasnovana na Jaccard indeksu ukazuje na nisku genetsku udaljenost populacija. Rezultati su pokazali da ISSR i CO1 markeri imaju Primljeno 10.VIII.2021. Odobreno 28. VII. 2022.